Description :
Non Conding Region
Location :
Scaffold_1:89637- 90074
Sequence
437 bases(100 bases per row)
AACGACACTTTGTACGCCCTAACAAAATCTCGTGCAGGAGGGGCGGAGGCACTTTCACGCGTTGAAATCGCAAACAAATATCTTGCTGCCAGCGCAAGGC
ACAGTCCGGAAACTGTTGCTGGGGTAACGAGGGAAATTGTGCCCACATCGCGAGCTCAAATCGATTTGGGGTACCCTTCACCACTCAACACGAAACTGAA
CACTGCACGCCTCGCTGATCTCCTGCCTAGCTTCGCGTGGACTCCAACAGATAGGGTTTTAGACGAGATCAGTCGAAGTCTGATGGCTTGAAAATGCTAC
TTCATTCAGGCATTATTCCTTTGCATTCATTagtgggggggggggggaatATGCAGAACGCAGTCACCAAGTAGTCAAACCTACACAAGAGAACGCGCCC
CACTCGCGGTGATAAACAAGAGCTTTCCAGTTACAGT