Description :
Non Conding Region
Location :
Scaffold_1:89617- 90413
Sequence
796 bases(100 bases per row)
GTTCTGGGCACTGGGTGGCGTTGGCGCCATCGTGCAAAACGCTCGATTTAGAACGAGCCAATCAGCGTGCAAAAACGGGTTTTCGCGGACCAATCAGAAG
ACGCGAATCAGCGATCCGGCGGTTGTGGGAGATCAAAGTCGCCTTATTGGTATGGATGATGGAAGCGTTCCCGTTGCCTATTGCTGAGCCTAGCTGGCCT
CCATTGGCGTGCCGACGGGCACCAGCATCTCAGCGCGGAACGTCCGACGGTGCGGGCTAAGCCTCGTTGCTTGGCGCAGCTCGAGACTGCTCACGTCAAC
GACGCGCTTTTCGGGACCTTGGGATCCCAACCGTCTGCTTAAAGCTGCAACACATAGAACGAGCGGTGACATACGCCGTTGTTTCTATGGATACGCTCAC
CAACCTCGCTTGTACACGCGGACAGCGGCGGCTCAACGAGCCGAAGCACGACATCAGCGTCATCGCAGACGGGTCTCCATCATTTAGGTTGTGTTCCCAT
TGCTCGCAGTAGCACTACTCGTACGCAGACTAAGTGTGCCACGGTCGTTGGACCTCTTGACACGTCGGTCGTTGGCGCAGTGTCGAGCTGCCGCCGCTTC
ATCTGAGCTCTCGAGCTCAGTCTCTTCCATGGCGCTACCAGCCGCTTCGTCAAGAGCATGGATGTATGCGAGCTGGAGGTCCGATGGCCACCGCCTGGAG
CTACGCTCGTGTATCATCATCGCGAATTGCGAAACACGTAAATAGTGTACATGCATCACGCGAATAGTGTACAATTAATTACTAGGGCTCCGATCC