Description :
Non Conding Region
Location :
Scaffold_1:89570- 90062
Sequence
492 bases(100 bases per row)
TTCGTAATTTTCCCTCCTTCCGAATTATTATTTTCTAAAGGGAATGACCAAAAACTGAGCGTGGCAGCAGCATGAATGGTAAAATAGAACTATTGAGACC
AATTCTGTGTAGCATCCTTTGCGCAGGAACAGAGCATCCGCTATTATGATCAAGTCCTGCTGTATTTTAGAAGCTTGGAAGCGCATGAATAGGACTACTG
GTCTGAAACTAGCAGGCACAATCGAAATCTCCACAAATATAGAAGACTTGATGCGCTCTGGTATTTACAGTCAAATGATTCATAATTACAAAGTTATAAA
GCGACAACACAAAAGCACCACTGGTTCTCGTCTATGAGTCCTCTTAGCATCTAGTGGCACTAGCATCGATTTCTAGCACTGTGGGCTTGCATTGCTTCTC
TAATTCATGAGGGTGCTGCAGGCTGAATCAGTAAAGTTCCTGATCGTCATGAGCTCTGAAAGAGTTCTACATTCGTTCGTCAAACTGCAATA