Description :
Non Conding Region
Location :
Scaffold_1:89490- 89653
Sequence
163 bases(100 bases per row)
CGAATTAGTGCAATGTTCAACAGCACGTGCACCGGTACAAAATATCAAGTTGGTTTAGCTCAGGAACGCCAAATACATATAAGTTCTACCCTTGCACCCT
CCTGAGGGTTTAACACACTACGGTTCATTTTTCACACATAGTTGAGGTCGCTGCTGTCGACTT