Description :
Non Conding Region
Location :
Scaffold_1:89016- 94607
Sequence
5591 bases(100 bases per row)
ATGGGTATACGGTGGTCCATTGTGTAGCCATGAGTTATTGGTCAACGAAGTGTATGAAGCACAATAAAAAAATGCAGAGTGCATTCTTTAGTTTCTATGG
TGCTTTGACGCGGACTTTTCAGCTATGTGAGGTTACGTGAATATCATCTGCTGTATTTGGAGAGGAACCGTTTCGCGCTGGTTAGCAAGGACTTTGGTGG
AGCATGCACTGGTGCCATGCAAAACTTGCCGTTCCGCTTGCTTGTCACCAATGATTTGGATCTCCAGAACGCTGTGCGACTCGATCATCACGAGTTGCAT
CCGCCTGGCACCGTTGACGAGTCCAATTCCCGGTCTGTGTGGACATCTAAACTGTAAGTACCTACTTCTCCTTTGGCGATTCtttgctgatgttgaagct
ATTGTAGAAATGGTTCGTACCCTCAGGAGCTGGGGCTACTTGTTCTCTCTGCACAATCCGTAACGATCCAGGCGCTACGCCTGACTGTCGGATCTACACG
AGCCCCAGCACAGAGTAAGTTAGGTGCATTTTTCAATCTCTACGGACACTTTTTGACCGTGCATACAGTTGCAATTTTTGCTGCTTTGCCACCGCCCCTG
GAAAACAAGTTAAAGCCTACCAGCAGTTCTCTTGATGCCGTGTCCCGATATCTTAGCTCTGTTTGGGAACCGTGCTGGTAAGCTTTTCATCTTGAATTTG
TTGCGTACCACGTTGGGCTTACCGTCGCTATGCGCAAATGTTTCAAAGTGAACCTCTCTTTTGGGAGGGGTATTCGTCTGCTAGGCGAGGCAGTCGCCAT
GACGTGAATACCAAGACTGCTCGTCTCCATCTCACGCAGTGTTCATTCCTCAAGCTCGTAGTACACgcatccagcaacaaaatcGGTAACGAACCTCGTC
AGGTATCGTTGAGCTTGACACGATCTCATCTCACTGGAAAGCAAGTGTGCTAACCAATTGTTGTAATTCCACACAAGGTTGCAATCGAGGATATTGAGTT
GCGGGGCACGACACAAAACTTGAATCTTGATCAGGAACCTCGAAGCCCTCTCCTTCTCGAGGACAGTGATAAGTGCTCTAACCACTCTGCCCATTTTGAT
CGAATTCGTCGGTCAATACTGCCGCTGCCCACCAAGGACATGGACGATTTGCAAACTGTGTTGCTCGAAGCAGGCGTATCGATGGATCTAGTAGCCCAAG
TTGTTTCCTTCCAGCAAGCCACCAACAACGCAGACCCTGTATGTTTGTCTCCCATGGACCAAGTAGATAAGCTATCTCTTACGAACCTGGACAATCTTCC
GGACAGCAAGCGCATGAATGTTCCCGATGCCACAACGCTATCTCGACAGGGGAGCAGCGAAGTCCAATACAAAGACGCGTATGGTGATCAACCGATCTCG
CCATTTGACATTTTACTTCGCCAGCATGTAGAGCAAATCGCCCGTGAAACAGCTTTGCTTGAGGACATTCTTGCTACCCGCATTCGCAAAAGCGCGGACG
AAGTATTCATGTGGCAATCGCCTACAATTTCATCTTGTGACCCCGCCAACATCACCGAGATTACGATATACACGTTTGGCAATTTTTTTACACAATGTCT
GCTTTGTGGAGGATCAGACATTCAGACGACATGCATACAAATGGCTGAGCACTATGCTTGCCTCTTGAAGGAATCCATtggagcgactgcagcatttgaa
GGCATAATCGCCGTTATTGCGCTAAGCTTGCGCAAATCAAAGTCGTCACAAGTCTTTCAAGGAGCTATCCATTTTGCACACACGGTCTTCATGGCCGCGG
CAATGCCAACTGCCCATCAACTTAAGTTTGTTGGGGACAAGCCTGATActtgcagcaagcgcagcgACACCACACCCACCAACGAATCTTCAACGTTGGG
ACTAATTGAAGAACTCGCACACTGCAACTGGAGCTACGGTCTGGGAATCGTGCTGGGATCAACAATCGCGAATCCGTTTTGCTGGAATGCCACCTCTCAC
ACGAACATGAAACTAAAGTCACGAATTTCTGCGCCTCCGTCGATCGACAGAGAGTTTCTACAGTTTATCCGGATGCTGCTTGAGCAAGAATTAACTCGTG
AAAGCTTTTTCGAGGAGCTACTCCATGTAGATATGCAGTCCGCGAAAAACGAGAATGATGCAACCAGCCCACTCACAATAAACCGATTGCGATTGCTCCG
TTTGATCCTTCGGAATGAGCGATATCGCTACAAAATACCAGAGAACGTGAAAGAGAGTATTCACACACTTTGCAACAGCTACGTCGACGAACGTGATTCT
TCTGAGTTGCTCGACAACGAAGGAGCTGTTAAACAATATGACCGAAACGCAGTCCCCACTCGGCTCGCTTGGGACTGTTTGGATGAGCTTGAACGACTAA
CCTTGCGTCCAAACAATGGGGGGGTGACTTCCCCTAAGAAATTGTTGACAACCGTACGCAGCAAACTTGAAGGATCGGAACATCCTAACAGCTACCATTC
ACAACGTCATCACCATACTGCTCTGTGTATTCACGATCCGTTAAGAAGtagtgaagttgaagaatGCATCATCCAAATGAAGCGCTACTTTTCGACCCAG
CCTCGTCCGATTGCACTCTATCGCCACTCTTTTGTGCGTGGAAGTCTAATTGATGCGGAGAAGAATCCAGCGGAATGCCATAAGGTGTTTCAGAAAGGAA
ACATCGCCTTTCGGGGACAAGTTGTCCCTCGAGCTCTGCCTACGACTACGTTTCACGAAAAAATTAAGAGAAAGACGATGCCATTCGTGTTTGATGACAG
CACTTTGAGCAATGAGAATCCGAACCAGTTGCCACAACACTCGCAGCAATCATCCAAGCGAGAGATTGTGTCAAGTTTTGCTGAATTTCGAGGAGCAATC
GAACGGCGCAGCGATACTCCTAAACGGTCGAGTAGAGTCGTTCCTCAACGCACACCAGCTATAGTGAAGTCTTTATCGACTACGCTAAGGAACCAATTAC
ATGATGATCCAGTCAGCCATGCGAATTCCCTGGTGAACAATACAACAGATCCAAAGAACTTGTTGCAACATTTCAAAGAACGAACCCCGCGGTCGCGTAT
CGAACAAGTACATCAAGCGCCAGTGGTTACTCAACCAGCTCCCATCAATTCACTTAAGACCCCATTAACCACTAGCCGAATGCCACAACTGCCCGAAAAT
CAATTGGGGAATATTCCACCTCGGGCCCCAGATGTTCCCAAGACCAAGGGCACAAGCAAAGGAAGAGCTACAAGCAAAGCCAACGCCGGAGGAAAAGACC
ACGACAACTGCACAGTTCAATAACAATTTATCGTTAACGATCTGGTAGCCCAGGGATTCCATGGGTTGGCACGGTCACTTGGTCTCTCTGACGCAAAATT
TGAGCATACcatcgttgctgctcctgaGGTAATCTACGAACGAAATGTTCGACCACAAATTCCtcatcaacgtcagcacAAAGAACAAGGACCAGATCCT
TTGCTGCCTCGCGAACAAGCACATTTTCATGTTGGTCTGTGTTGCTGCGTAGCAAAAAACCAAGAACGCGCTTCGGGGCAATATCGATATTTGCGCAACA
GTGAAATGACAGTAGTAACGCTGCTAAGAGTTTCAGCAGCGCCAGTAATTGCTGGTCCGAGGGCTGGAAGGTTTTACATTCGACGTGCTTCAGAAGGAGA
TGTGTCACGAATGTACTTCTTGTACGCGCTGCTCCAGCGATCTACAGAGTCCGTCGTAATGTTAGGATATGTTAGTTAAACGCTACCTGATGGGCTCCTA
TATCAATAACAAACTAAAGTGGCAGCTATACCTTCAAAATGgtgagagcagcagcattgcgcactgctgcatcacgaTCACCAAGACGATTTAGAAGTCG
CTCCACAAAATTGGCAATCTACAACACAGAATAATCACGCGACAAGCATTATTCAACAAATCGCTTGACGGAGGGAGTGATGTCTTCCACGCAATACTGA
CGTCTGACTTTGAAGCGACTCCGTCTTGAAAGTGTAGCAAGGATGCCAGTAAAATTCGTAGTAAAGCGCAAGTAGCGATAAAAACTTGGTTGTGTAAATC
GCCCAGCGCAATTGTAACAATTTCGAGAGTGTCTGCATCTGTTGCCGAAAGTTGCCGGGCGGGAGGGTTACCAACTCTCGTGCCAGTGGTTGTTGAAGGC
AATAAAGACTCTGTGAGCTGCCACAAAAGATCCTCACGTTCCTGCCATGTATCACTCCGGAGACGGTTAAGGATATCACGAGGCGATATATGTGAGTTTT
CGCGTCCTAAAGTCGGTAGAGACCTAGGTGACGATGACATCTGACGCCAAAGAATCTCCTCTTGGTGTTTCCTTTGACTTTCCAGGTCAGCGAAATTTTT
gacaagatcatcgaggCCATATACTTCGTTCTTCCTTTGCAATCTTGATGAGCTTGCAGGGCCTAGGTTCTTCGCTGTTACTGGCTGTATGGTTAGCGTT
ATCAGTTCGAGCTTATTCATTAAGCgatcaccttcttgttccaaGAAAACCCAAGGTTGGACAAGCTTCTCGTCACCAGCAAACTGCGCTAGCTGCTTAT
TTATCTGGATTTCAGTGCAAATCTGCTCAGGTGTTTTGTATTCCTGAGTATCTTGAATCCAGATATTGGTTGAGCGAGGTGATTTGATCACAGCACCATG
CGCCGCATCGGACAAGGTCCAATAGGGAGTGGCCTTTCCACTTGTAGGCGTAGACGACGAAAAATGGTTCCTGAATTCTTTCGACGGGCTCTTTAGAGGA
GACGATAGCATCGGTAGCACGACACTTGCGGGTGTCTGAGACCCCAACGCTACCACCGATGCCAGTCCAACTTGACTAAACAAGTTGGCTCTTGTCTGGT
GGCAAGTGTGCAAGACAAGACGTAGCAAGGTAACTTTGGAGACTGGTCGGGGCAACTGGACCTCTTGAATCTCGCACGCTGTGAACTGCATcgcttcatt
gctgttgaaaCACACGAAACCAAGTCTCTCGAATCTCACTCCTGTCCTTCCATTGTGCAGTCTATCACTAGTACTCGATGACGTGAAAATCTCAATTCGA
CTCGCGACTTTGAACGGATGCGATAGCAAGTTCACCTGCAACAAATACATTCAGTCAGAATAATCATCCGAATGATAGCTTCAAATAGGCAACACAATAA
TGGAGGTAACCTGCTCAATATGTGTCGGCAAGCCTCTGTTAACTCGAAACACGAGTTCTTGTGGGAACTCGCAGAATTTTTCGGATTCCCACACTGGTAG
CGATGTTGAGGAAGAACCAGATGCGTATTGGCGTTCAATTGGTGACGTTAAGCTTGTTGCTGGTAGCCCTTTTTCCTCACTGGACCAATGCACAAGCTCT
AGATGGATCGACATTCGCTCTCCATTGCTCAGTACGTGCATCATATTGACTGCAAAATAATAATATTTGCTAAAaatgcacttcaacatccttACAATCA
CTCTGAGAAAGTcatgatgtggtccacaccaaTTCATTAATTGTTCCAGAATGCTGGTTCATTCATTACCCAATAACACCAAATTAAAGTA