Description :
Non Conding Region
Location :
scaffold_1:88959- 91515
Sequence
2556 bases(100 bases per row)
GATCCACTCGCTATCGGTGCAGCCCGGAGACGACGAAAAGAGACTGTGAACGAGCGGGTGGAGCATATTCTGAGAGGGGCGTTGCAAGACGCTGAGGAAG
AAGCGCTGCAAGACCGAGAAGGAGGTCCTGAAACACGTGGGCGAGCATTGCAGCGGTCCCGTCAATTGGCCTCTCTGTACACAACGTCGACGGATAGCAA
GTTCCTTCGCTCTCGAGCAAAACGAGATGCCTCCATTCAGCGGTGCAACGAGGTGAAGGCTCAACGAGACTCCGAGTCGTCTGTACGACGTGCCAGGTCA
AGAGTGGGGTCAGATTATACACCAAGTGTGATCGGAGAGGGTAACGAGAGCGAAGAAAGTGACGACGACTCAGTATCGCAGTGTCGGTTAGAGCTGGCAT
CGCCCATCAAGCAGGGTGTGAGCTGGGGTGGAGCGTCTTCTCCATCCCCAGTCTCTCCAATCTCAATGGTAAAGCCAGCAAAACCATGGTACGGCTGTAC
TGCAGCAACGTTGAAGGAGCAGGTACCCCTGGGCGTCACACTTGACGCTAAACTGCGTCGATATGGAGCCCGAGGTACAGCGAAGCTTTTGCACGGGTGG
CGATCTCAAGAAGCGTTGGGACCGCTATCTCCCATTCCGCTGGTTGCATCTGTCGATACATTTGTGTCAGGGTTGAGCGGCTCACCTTCGTTATGGCCAC
CTGAAGCCTTCCACCCGACCGGGTCCAACCTACGCGTTACGATGACTCGTTGTCCTTCGTCTCCAATCGCAGTCTCTGTGGAAGTTCCTACCTCCGTTGA
TGATCAGAGCTCCAATCGAGTGGACTGTCAAACGCACACGGAGACGCAAAAAGGTTTACAGCAAAAGGCAAGACAAAAGCTTCGAAGCACCTACAACCGA
GAAGTGCAGGTCGAACGGGAGGAACGCTTGGAAAACCAGCGAGATCTCGCTCAGTGGCAAAGCCGCACTCTTCATTTTGTCCCATCCTCTGAGCTCGCTG
CGCATCGAGAACAGCAAAAAGGGGACCCGCATCTTCGCCATCGACGTACCCAAGCCTCGGCCATAGTGCAGACACCAGGGTATTCACCTGAGAAGCAGCG
CAGCAAAGAGTCCAGAGACTTGAAGGGCAAGCGGTTCAAGCTGCGTTGGCGCTCATTTTCAAAGTTGCTTGACGTAATGCGACGAACGCCTTGTCGAAGG
CCTGTGCTACAAGATATGGAGAAATTATTCGCCTTGTCCAGGGAGCTGTGCGCGCTCAATGCGCTCGGAACGTGCATGCTCTCGCGAGCTCAATTCATGC
TGCTCATCACGAGGGAGTTCCCATTGTGTGATGCCAAGCACGTGAATCGCTTGTATTCGTCGTACGACTGGCAAATCCGTGACTCAGTAGATGCTCGATT
CGTTCTTGGGACGATGAGAGCAATGCGTGTGCAACAAGGTGAGCCGATAGAGCTCATCTGCAACACGCTCCGTGATTTTGACGACACCACCGCCGCCAAC
ACAAAACTTTCAGATGACAAAGCTGTGGTCTCGAACGGTGTTTGTTTAGCGAAGGCTCTGTCGCTTTGTTGTACCAGTGATGAGGAAGAGCGCGAAATGG
AGAGCAGAGCCGACCTCATTTGGACCAAGACACTTGCCTGGCAACGACAAATTCTGTCGCGACGTCTGCGCGGCGGTGTCCGACTCAATGTTTGGAAAGC
ATCAGGGATGTCGCTTTCGCGGGTCTCAAGCTCTGATAATTGCAGCCAAGATGCCGGCGTAGCGAGCAAAGTAAGAGACTGTGAGACCAAGGAAGACGAT
GGCGAGGAGGACGTAGAGGACAGCAAGGAGGAACTTCCTGAGCTCAGCCAACTAGTAGATGAATCTCGCGTACCTGTGCGGCGTATCCGTGAGGCTCTCA
AACGAGAGCGAGAGACGCTGACAATCTTCACTCAACAACTTCTCCAACGCAGGCACGAGTGTCTTGTTGGTGCCAGCACGAGTTCTCCGAGGCAGTAATC
TCACGTGTTTTGGTTTCACGAATCAACATCCTTTGCATCTTTTTATTCACGTCTCGACGATTGATCTTTGCAAAGAGAAGGAGGCTATGATCGATAACTG
CGTTGATTATTAGCATTGACGACATTGTCCGTGCAGTTTTCATGCGCATTTATCACTTAGATTTACCTGCCGACGTCATGAGCCTCGAACACGAAATACG
GCGCCGACACCATAATCTGCATGCGTAGTACGGAGTTGCCGAGTGTGCGAGGCGAACACAACCGGTGTCTACATTGAACACACCTGCGAAATCTCCCAAC
GTAGGAGAAAGCAGCACACAACCATGCTCGTTGCCGCAACATAGCAACTTCAATCACTTCGAGCGCAACATAAGTTACAGCAAACACTAGCTGTTACGGT
TCCTAATGGCACTAATCACAAAGAGTGACGACACGTCAAGAAAAAATCTGCTTGAAACTGGCAGGAAGCGTGCGGGTGGTCGCCATTTCAAGGTCAAAGT
CTCACTTGGCGTCGGCAAGACTTACCGAACGAGAAGTTCCATATCCACACACAAGA