Description :
Non Conding Region
Location :
Scaffold_1:88657- 90756
Sequence
2099 bases(100 bases per row)
ATCCTCTCGTCAGCCTCGTGCTCCTGCGGTTCCCTCTCCTCGCAACGGCAACGGCGCGGCTCCCGTCCATTGCTATCGACTGTTCGTCCATCATCCCCTG
TCGCTGTGTGCGGGCCGCGCCGTCGCCGTCTCCATATCCAGTCAGCGCCACTCACCCATGGTTGTTCGTCTGTGTGGTTTACTTCCCGTTGTGCGATTCC
CAAACACTCGGCACAGGGCACTCGAAGGCACGGGCAACTACTGGTTGGCTGGACAGAACGGCACCAGCGGCTTCAAACgaCCTTCGCGCAACTTGATCAC
CGCTTTGAATACAAGAcGGCCCCCCCCcTGCAGCTCTtATtGGGCTGgATtCCcGgcAAgtcGgcTCCATTCATGTACCAGCCAATCAGAAaCGGACAAG
GgCTAGGgAGGTtCCTCGAGGCATACCTTCAAGCGACCTGAAAGGAGTGATGGTCACGACGAAGACAAGGAGTCATGTGATTGGTGGAAAAAaGTCAAAA
aTATCGGATCCATGGCAATGGAAaGAAAGAATCGAATGCTGTGAAACGCTGCGATTCCCGATAGTCGCCATGGCCcGCATCGCGCTCTTCGTGGCCCTCT
CCATGACGCTAGCGGCTGTAGATACTGTCGCATCGACGTCCCATCTGCGTAGCGACTCCGATGGcGTCTTCGATCCACTGCGCAgTGCCCCACTCGCTCT
TGCCACGACGCCAGCTCATGTTGACCGTGTGTACGTCTACGCCAAGGaCTTCCACcTGGACAaGCCGTTCTCGGTGGATCTTCATGCTGGTGAGTCCGTG
CTGCTGCCcTTcGAGCCCATCCGCGACAGATTATtCCcGCAGGgTGGTGGTGATACGACCAAGCTCGCTGTGGGCCTGGAGCTGAGCGTCTGCGCCGGCA
AAGTGCTCACTTATGTGGCCAAGGGTGACAATCACACCACGCGTTTTTCGTCAGCGATGTACCAGTGCGTGACACTCACTGCTGCCCAAGATCAAAGCGC
CGTGGACTTGTGCCCTTTTGTCCGCAGCGACAAGCAGCTCGCGATGCATGTGAACCTGACGAGCGTCACGGGCTTTGTGTTGCGGGCCAAAGAGGGGGAG
TCGGCTAATGTAGTCGCAGTGTTGAGGTGCACGAAAGACCAGGGCGCGTATAAGCAAGCGTTCTTTATTGGGGATCCATTGTCGCCGGCGATTTCACGGA
CGCTGAATGTAACGTCGACCTCGAAGACGACTGAGCTGTCGTTCGAATCGGCACTTGTATGGGACGCATTCCATCCAAACAACACCTCGAAACCGTGCGA
GAATTGTGAGTACGCACTTCATGCTCAGTTGGTGCCTCCGACCAACGATTCGGTGCTTCCTGATCGTCGCCCTCCTCCTCCTCACTGCATCATTCGTGAC
GCTGCGATCCAATACACGCTACCAGCCACGTCTACTGGGGCAACTCAGCGCGTTACCTTAGCTCAAGGCTTTGCCGACCAGTTTCAAACCACAGGGGATT
ACCAATTCGTACTCGTTGCGTCATTACCGTCGTCATACAATAATGGCCATGTGGCAATGCTGACGTACGCTCCAACCCGAGTCAATGTGACAGGTGAGTA
ACACGCCTCACATGCAGTGTGAAGTGCACAGTCTGACGCTGCAAACGTTTTCGtACTCTGGCCGATAGCTCCGTCTCATCTTGTTTGTAAGTGCTCGCTT
GGAGGAGATCAGTCTGTGCTTCTGTCTAACTTCTTCTTTGCAGCCCATATCTTCGTCATACTTCTAGTAGCCAGCGCTGTTGCTCTTCTATTCTTTGTTG
CTGTCAGGTCAGAGGTCCCTcGTCGGATCAGGGGAgACAATGATGACCGTGACACAGCTCACGACGATGAGTCTGTCAGGCTGCTGGCTCAAGTGCTTGC
AGAGCATGCTGAAAAACaTTCAGACAACGACGGAGATGAAGAAGAAAAGGTCGATGAACCAGTGGACTCACTACTTGACGCTATCCGCAGAACAAAAGAG
CGCGAAACACCGCAGGCATCGCCGCGAGCGAATACTAACCAGGGTGCTATTCTCGATGGATACCATGAGATCAACTAGATCCAAACcAAACCTGTTCAT