Description :
Non Conding Region
Location :
Scaffold_1:8853- 9691
Sequence
838 bases(100 bases per row)
GCGATACCGAAAGCGTTGTTCACACGAAGCAAAATGGAGAATGCCGTCCGCGATCGTCGAGCGGCAATGCGGTTGGACTGGGTTGGGTGTGTCTGTCGTA
TCCAGTGCGCACTTCACCGTGGACTAGGGTGGGCATCGAGGAAGTGCCGCGATCTGGAAGCAGCTTCTGTGAGAGTCCTTCGGTGCTCATCATTGGACTC
GCCCATATTTTTGAGCTCCCAGATGGGTCCAAGATTCTCGGGTGGTTCAAGAAGTGAAAGCGCGTCCAAGCTATACTGACAGTGGATTGGTCCGTTAAAG
GTGACGCGACGAGATATTATCCAATTACATAATTATTCTATAATTGAAATGGCCAATCCAGAGGCGCGATTTTTTCTGGTGGTCTCGAAGCAGCGTCAAA
ACTTGCATTCGCTGTCGGCTAGCGCGACCACAGCGCAGTGTCTTCATGCAGGTACGCTTCGGACTGTCGCTCACTCCAACGCGCGCAATAGAGTACAGCG
GTGCGCTGGGAACGGTCGATCTCTTGAGCGCTGGCGAGCTCGAGCAGCTGAGTGTTTTCGACACCGCTCTTGAATCTCTAGCTGTGTGACAAATGTCCTC
TGATTGGCCAATTCAAATTTGCGAGCGAATCTGAGGGGCTGACAGATTGTGACTGATTGTCGGATCGACTCGATTGTATTGTGCAGCAACATGTCTGTTC
AACAACTAGCTGCTCGCCAACGCACATGAAACAACTTGCTTAGTCTTGCCGTTTTCTGCTCAGCGACGCACCACGCAAGCGACGCCGCTTTCTTGAGACA
CCATGTCGAGAAGACGAACGGAGCGTATGCGGTAGGTT