Description :
Non Conding Region
Location :
Scaffold_1:88475- 88630
Sequence
155 bases(100 bases per row)
GAGCGTTATACCATCTACGACCAGTCATTTTCAAGAATGTCGCATTGCTACAGAAAACTATCACAGTGACCTTAAAACAATGTTAAAAATGAACGATACA
GGTGTGATTGAGACAGATATGAAAATACACCAACCCGTTGGCCAATGGGTCAGAA