Description :
Non Conding Region
Location :
Scaffold_1:87979- 88396
Sequence
417 bases(100 bases per row)
ATCCAGAATCAGGAATCCATCCAGTTATAACCGAGTGTTACGATATGTTAGGAGTATTAAACAGGTGGAAATACAGTATAGGTCCCGCCCGACACATGCC
ATCGATACGGCCAGTGCGCTTCAAGACTACGTCCTCCAACAAGGATCGCTCGATTCAATACGGTGCGTTCACGAATTAAACGACGCTACTCGATACCGCG
ACGCTAGTATGCCTGCGAGAGGCAAACCTGGCACTTCGAATTCTGTAACACGTATGTGTTTTAAACAAAAGTGTTAGATACGTTGGTAATTCTGGCCAAT
CAACAACCGCGACCAACGATCTGCCAGCATCCAGCTGGCAGACAGGCAGCGGCGCCAGAAGCACACGACCGCTCCCGTGGCCATACCGCCCGTCCTGCTT
CAACCAAAACGAAGCTG