Description :
Non Conding Region
Location :
contig_1:87884- 88538
Sequence
654 bases(100 bases per row)
CGGAGGCCTGGAGGGAGGAGGGGGAGTGACGGACTGGTACTCGGACTCTGGCTTGACGACGATCGCAAGTCGGAGTTTCGAGACGACGCCACAAAACCAG
CCAGGCGTTGTTCCTACCTGCGACTTGGTACAGTGTACCGGTCCGTACCACGTCAAGGCGAGACTAGGGGATTCCTATACAATAAAACAAGAGCGGAAAA
TTTTGTGCTTGATAGCGGCGACCTTGCTATCAAGTTGTAGTGGCAAGATGCATCTAGCGTAGGTAGGTGCTGGTTGATGGAGTCATTTACGGCCGATGGA
TTCTTCTTTGGGCGCGGTTACGCGGCTCAATAGGAGAGGCGCAGTGACGTGCGCACAGATACTTGACACTTGGCGCGGTTGGGGATGGCTACGCTTTACC
CCAGCAGCGCCAACGCAATGCAGCTGCTTTCGTTACGGGTGGCAAGATCGCTCGTGACTCACTTGGATACGCGGAGCCGATTGTGTGCCTGTGGGGCAAT
GGAGACCTTGCCTCGATGTCTTGCTTCCTCGAGCTGCAACCACCGATGCAAATCAGTCCTGCGTGTAGTCAGCGCCCGCGCAACGGCCAACAGCTCACTA
CTTCCTGGTAGTCATGACTGGCTTGCCTAAAACTGTAGCCATCTCCGAATCCAA