Description :
Non Conding Region
Location :
Scaffold_1:87674- 88620
Sequence
946 bases(100 bases per row)
CTTGATCGTCGAAAGAAACCGGCCGGACACTGTCCGCCGCCATGCGCTCGGTCGCCTCGCCGTTGCCAACTGCCCGAGGAACTTTTGCGGCGTCGAGAAA
GTTGCGCAATGGCAAACGAGTCCGCCGAAACTTGCGCAGGAGCCCGCCGCGGATCAGGTAGCTGACGTCACTCGCCTGAAACTGCAGCCACGTCCCCCGG
TGACGTGCCGTTTCTTGTCAAACAAGAAGATCTTAGTCGCCCGAGATATGCGTGGCGGCGTGGACGGACTGCAACATGCTCAATGCCCAAGCCAAGCTCA
CGACAACGCTCTCGACGCAAATGAGTTGGTGCCAGCCACGTCGAGTGTTCGCGTTTGGGTGCAGCCAGTGCTGACAACTTCTACACATGAACGCCGTTCG
CCCGATCTGAGCAAGGAACGCGCTGCCCACCGGTGCGTCATTCCGCCCAAGTTGGAAGAAGCTCCATCAAAAACCAGTGCCACGCCGTAGCGTACCCCCG
TccgatacatgtacagcgaAGGCGATGGCAACTTGCCTGCCTCCGCTGTGGTGATATCGACCTATGCGGATACGCAAGAGCCAGCCGCTTCCTATTGCAA
CCAGAGTATACTATGCTTAGTACTCGACAAAGTACTCAGTACAATCGAAATCGATCAAAATGTGATTTACATAGTACTATGTAATAGTATTGTCAGCTGT
TTCACCAGTACTTTTGAGGCCGCCGCAGATATTCCTAAGTAAAATGCTAGGGTCAAAGTACATAGTACTACAGTACATAGTAGTTGTACTATTCTTCGAA
GTAGTACTGATATGCTACTGTCTACTGGAAATTCCAGTCTGGAATACTGGTATCACAAAGCCACGAGAGCGCAAGAGACAGCCGGCCGCGGCTCCCACAC
ACACAAACCGGTTCCCCCAAGCGCCAAACACTCGCCCTGGACGCGA