Description :
Non Conding Region
Location :
Scaffold_1:87642- 87885
Sequence
243 bases(100 bases per row)
TCCCAATAGACCATCGCTTCAACTTCGATGTGTCCTTGCTTTGTTTGTTCAGGTGGTGCAGGAGTCAGCAGATATTAGTAAATATTATTTGACATGTTTC
TTTCTATTGGCTAAAACACATCATTTCCTCTTcctattggtagaaaatcCGTTTGCGCAACCATGCGATCCAATGCCACAAGAATAATAgcaagcaccaa
gcagctCATTGCTGACCCTGCCGCATATTCCAAATCTCCGCCA