Description :
Non Conding Region
Location :
Scaffold_1:87576- 87932
Sequence
356 bases(100 bases per row)
AGGCGCGGATGGCGGGGAAGGGGTTCATTTACGTGATTGATGCAGGCGATGACGCCGTATGTAGGTTGGTTAGGCTTTTTAAAAACGTTGAGATGCCGGA
AATAAACACCCATGAGCAGGTGGCGGCTATGATTGGCCAGTAAATACGATATCAGATGCGACATCTTCGATCTGATTGGCCGAAACCATCTGGGATGACA
GTGCGAAGACGACAATCGTGGAAGATGAAGCTATGGCAGATCCCCATGTTCTCGTCCGGCTCGCGACGCCTCCAGTTCGGCATTCCCCGACTTGAAGCGG
GCGTCACTGCGGATCTGCGCGAGCGCTCGGCTGTTCTGTCTATCGACTGCAAGCGA