Description :
Non Conding Region
Location :
Scaffold_1:87525- 87701
Sequence
176 bases(100 bases per row)
GCGTTCCCTTCCTCGCCGCAGCTCAAAAGAGAAATGTAGAAAGATCGCGAAGAGATACGACTCATGATTGGCTGAAATAGTCCCCACTCCATTCCTATTG
GCTGATTGACTGATGTGCTTGTCACAAGTCACAGATATTCGACCCTTCAAATACACACACTAAGCGCCTTTCATTA