Description :
Non Conding Region
Location :
scaffold_1:87356- 87445
Sequence
89 bases(100 bases per row)
GAGGCGTCAAGTAGAAATTAAGTGGGGAAAGATGAAGGATTGTGATTTTTATGATGGTAGAGAAACCTGCTGCAACGGTGAAGTGTCAC