Description :
Non Conding Region
Location :
Scaffold_1:87266- 87535
Sequence
269 bases(100 bases per row)
TGGGTGGAGTTGGTATCTCGAAGAAGTGGAAATGGTCTCTGTAGCTCCTCGCTGCACAATTCTATATTATATGTTTTTGAAACGGCTTTTTTCCATTCTT
TGGCTTCAACTAGACCATGAGCTTTTTGAAAAGTCTCAGCCTGATGAAGCAGTTTTAGCTTTAGACAGACGGAGTttttggtgctgctgctgctaaaACT
GCCGGAAGACATGGAAGATCCGAGCAGCCTTTTTCTAGGACTCacaaactgctgcttgttAACGATCTT