Description :
Non Conding Region
Location :
Scaffold_1:87195- 88108
Sequence
913 bases(100 bases per row)
AATGAGAGAAGGAGTGGTAGAAGACTGCGAGAGGGTCCCAGAGCACGAAGGGGCCTTCAGCGGTTGACTGCCAGTCAAAATGACTAGGTACTGTAACTTG
AAGTGTAGAGCTGTCATTGGCGATGGCTACGAAGCAGGAAGCAGCAGCAGGTCAGCGATAATGAATATACGCTGTCGGACGAGACGAGCATGTACAGGAG
TATACGCGGATGATGATACACCTTGGTGTGGGTAAATTGGTCGAGCGTCAACAAGAGATTTTGGATCCGTTCTCAAGAACTGAGACATACCGATTTACAA
AGCTCAAGTGTGCCCACGTCGCAGGACGGATGAAAATGAAGCTGCTCGTAGGCATGCCAACGATCTCATTGATAGACTTTCCAGCAGAGCACCAAGTCCA
AGAAATTGGCGTACAAACCGACCGACTGAGAAGAACTTCCGAGCTTCGTAGAGGAAAAAAAACATGTGCGGACCTGACGACGGGCCCGGGTGCGATGTTT
GCTGTGCTGACGACTGCTGCGGATGTTTGGCTGGCCTGTGCTGCGCCTCGTGCTGCCTTGCCGGCGCCTCCGCAGCAAACGACGGCGACCGACGTCGAGG
CGGCTACGACTCGCCTTCTCCCAGGGAGGTGTACGTTCAACCTGTGGTTGTCCAACAAGGGTATGAGTACCCACCACCAGGCTACGGCCCTCCTCCTCCT
GGATATGGCCCACCACCACCACCGCATCGTGATTACTACTACTAAATCTTCGTGGCGAAGAGCGAGCGCATTGGTTCAGTAGCAAGAGCTCTGCCTCGTT
ATGAGGAAGGTAACGATACCAAACCAATATGAACTAAATAACAATGTTGAAGTGGCATTATCAGATTTCGGCCGTTAGAATCAGATTCAGCTCCCAAATC
GGCACTCGCATCA