Description :
Non Conding Region
Location :
Scaffold_1:87152- 87272
Sequence
120 bases(100 bases per row)
TGATACAAGAATGCTGGTCTCGTACAATTATAAAAAGTAAAAACAATTTCAATACTGAATGCAAGTGAGAGTGTGAAATACATTTCAATTGCCCTCGGCA
TACTTCGAATTTTGCCGTCC