Description :
Non Conding Region
Location :
scaffold_1:87125- 87929
Sequence
804 bases(100 bases per row)
GTTGCGTCGGTAGGTTTGGTACTCAACTTGCTTGGTCGGAGGCAAATCGCGTTGTGAAGGCAGCAAGGTTCATCTCAAAGTGGCGTGACTTGATCCGAGA
TTTCCAAGTTCTCGCTGACGTAGCGCTGCACTTCAATCTATCACCACGATTGAAGCGTGGCTGTGTTTTCCCAGCAAGTTATGTTTGTTTCTGTGGTTGG
TCATTGGTATCTGCATCACGAGTTTGCATGCAGAAGAGAGACTTCTGTCGTTTTGAGCCGTAGCATCCCTGGTCGTGTTAAAATTGAAATAAATGATGAA
ATTGCTCAAATCGATCGAGCAGAGTCAAAACTATGGACTCAGCTGAGGCTTGTGATGTCGCTGGTAGAAAACACTTTTGAGTCCCAGGGTGCACAAGGTC
GTACCGTGAAGGAAAAAACGTTTTAAGAGAATCGATCCAGCAACACAACCCTGAAAGGTTCGCCACCCCGTTCTTGCCGGCGATAGTCGTCCACCATTGG
TAAATAAAACTATCTCGGCACTCTTTCACTGGACTTTCATCGGATGAGTACAAGTTATCGATCCCACTTCCCCATTCATGATGGCGAGCCTCTCTTCTTC
CTTCTTTTGCCGCCGATCCACGTTGTCGTACTTGGAATAGTCTATGCGAATCGTTCGTTGGCGACGCACTAGAGTATGGAAGTAACCTTCTAACGCGATA
CCCTCTCAGTATGGCAACAGACAGAGCCTCACAGATAAGGCAGCCTCATTCGTCACTTCAAAGCGCCTTGGGGTTGCCAAGAGTCTGAAGCTATTGAACC
ACAT