Description :
Non Conding Region
Location :
Scaffold_1:86947- 88264
Sequence
1317 bases(100 bases per row)
ACGCCTTCAAGCTGCTTTAGATGTCGGTCTGATTGCGTTTGGTTGAACAGAGTCCAGCAAATTGCTCGCGCGAGACTTCGGCCCCGCTCCTCCTCCGCAG
ATGCCGTGGCTTTTGAGGAGCGTGTGGCTGATGTGCTCAAGCGGATCTTCGTGCGTCACGCTGGCACGCTCGTTGAGCTCCTCAACTGGTGAGTCCAACG
TCTCGACTGGGAGAGCGAGCTTGAACAGAGGCTGATATGCTGCAGCATGAAGGGGCTCGAGCAGACCGTACAGACACAGCAAGTGAAGCTGATCGTCGTT
GACTCTGTAGCTGCGCcTCTTGTGAAGGTGGGATGCACAaTCAACGTAGtcGTCAAGATCGAGCTGACAGAATGGTGGTTCTGTGCCAGGCCCACGACTT
GACTTTCTCTCAACGGGAACACCACATGCTGCGCATTGCCCAGCGACTCAAGTGAGTACTTGAGCACTGTAAAGACAGCAACAATATCTCGACTCACGTG
CCAAGTAGATGCGTTAGCGACGTTTACCAGGTTTTCTTGATGGTCACCAACCGAGCCTCCACCGTTCATAGTGAGTGTACGTACGCACCTCCCCGTTGTG
AGATGCGTCATGTTCTGCTGACATCAGTGCGATCATGATTCGTTAGTTGGCTCATTTACCAAGCCAGCCCTGGGCGAGACGTGGGCGCACTGTGTCACCT
ATCGTGTGAGTTACGCTCGGTCTTCGtGCCTGTATTGTCTGTCCTCATACAGTGGTGGTCGTGCCAAGACAGCTCGTCCTAGAGAGGCACATTGCCTACC
GTGCCATTAGTGTCGCCAAGAGTCCGTCTTCGGGCGCTGTCGTACAGCCTTTCGACCTCACAGTACGTTTGCGAGATCAGGAATTTCAACGATCGTCCAT
CACATGTCATCATTTGACTAGGAATTCGGTGTCGAAGCGGCGGAGGAGCCGATGCAACGTCATGAGGACGAAGAAGAAGACTTCTCCATCCACGATGACG
TGCTGAGAGACCTCGACCTCACAGGACTTCCAGCCGTCGACCCATCCGGCACGTTGCGTTCTACCCAGCATAGCGATCTCGAGGAGAGCACACACGACAA
GAAACCACCTACGCCACCTTCGCCTCTGGTCAGGACTGGAGGACTCGCGAGCGACGACTTCGTGAGCGACTCGAACGACGAGAGCGACGGCGGGTGGTGA
GCGACACAGAGAGGGATAAATAGAGCATTCTGTGTGGCCGAATCGCTGGGAAGCGTTATGATGCTAGTGTATTGATCAATCAGGAGCCCTGGCTTGGTCG
TCTAGACGCCACAAACT