Description :
Non Conding Region
Location :
Scaffold_1:86893- 90430
Sequence
3537 bases(100 bases per row)
tcgatgactttttctatgtggtcgaaggtctacaatcgcattcttttcggaaccctattctgtcttttaactggccaatattccttttatcaatctccaa
ttggtcgaaaccaatttgtccagaattagatggttcagagctcttcattatgaacatgaacctgcagatgcaagatggtgccaccttcgcttcgctcccc
actgaggtggctagagaggtaaatgatctcatccagaacaaaagtatgacaggttctgtctatgataagaccaaagcgcgaaacaaacccaacatgacgg
acacggagcgcctgaatatggctgagttcctgctccagcacagccaaggcgaggcccgcctgcctcgagccgtcatctcctcagctgccgacaagtttca
ggtgcaccgtaatactgtttcacgcatctggaaccagatgaagacggcgatggacgctggagcctccgccgacgtcgtgatgaagcaggcattatccaag
aaacgcggcaattgtggacgtaagaagaaggactattctgcagcgttggagaaggtcaagcagctgccactgaaccaacgaggctcactaagagcgctat
caacggctgtgggtgttccacgcaccacacttttccgacttctaaaggatgacacagacaataggcccactgacactatggattacgagcatcaagaaac
tcctagcaacgtaccgaagacaacgatcgccaatgctattaaaccaccgctgtccgataagaataagcgggatcgactccggttctgcttcagcaagatg
cagccgaacggcgtgttcgacgacatgttcaacgtcgtgcatatcaacaccaagtggtgctcgctgcctggcagtcgcaacacgaagaagaccaaggtaa
tgttcctcgttgctgttgctcgaccgcagtgggatcacgagcgacagcagcagttcgacggcaagcttggggtctggccgtttgtcgagactgacccgga
ggttagtgtgttaccatgggaccaagcagcagctcacgctggacgagcgatccgagcactggaaacgatcaccaagaaggagattcagaccatggtcacg
aattacgtcattccagcgatcaagacgaagatacctcgaacgcagcacaaccgtcgacttttcatccagattgacaacccgcaggtgcgcttaacggctg
acgaccacttggtagcagagcacggcagggcagacggctgggacattcgagtgcagcaccagccggcttacagtcctgagctggttgtgctcacccacag
ctttatgaagactatttatccggaggtgacgcaagttcgtaatgcagccatgcagttgacgcctatcgaagagctggttacaatcgtggagcattcgttt
gcttcactccccaagcggcagatcgacgatgcatttctctccttgcagaagaccatggagtgcgtaatgctggcagagggatccaacgacttcgattcca
aggaagccgcgaccaagaaaagtctacagcacgacggcagtttacctgtgagtgtattgtgcagtcgcgaagcgttatcagcatgccaatctgccctaaa
tattccacaagaatgatttgatcctttaaagtcatggtctattagctaagggtggtgagtttttataggcggtacggcattgccatttccagtgcacaaa
cgaacgccagggggcagatatctgtatctaattacattaaaaaaacatcgtcatttcagcgaaactattttacattttgcgcttatgatgaccatcaaat
tgttcgggtacatgtactctgcattttcaatcatccgtgtccaacttttgaagaaataaacaaccgaaacaataaacgatgatcagctaagtactggaag
aagaatgaagaaccgacgcgatggcggcagacctgaacttcaaaggcaaatgagccgttgaagtcgaatttcatcattcacgttgaagttacattatgtg
caccacacaacatggggcgcaaattcaccctttccaccaatcacattcgtgaagtctagttgcgtccagttggaactgtctcctccatccactaaacaaa
agacagacgaagatcatcatggcagagctgcccgctgtcactgctgagcccataccggaggctttgctggccgtcacagagatagcaaccgaaattccca
ttgagagctccaactcctccgacaaaaaaacgagtgcatggaaagaacgtggcagtaggaacttaacgtacgatgagcgtcgcgctatgctcgacttcct
catgcagcggcgcgtggaaaacaccaccaaactggcgcgtcacgccgtcacagacgcagctacagagtttggcgtagaccgtcgcactgtctcgaggctc
tggaagcgcgcggtgcagagcttggagaagggcgacgaggtgtgcgacgtcgcgtcacggaaagtcggacgtcgagggcgtcggaagcgcgactggtctg
tggaactggagcgtgtcaaggagatcccattggctcagagaggatccatccgcgcactagctacggcagtcgggatccccaaaacgacactgtatgaact
gctgaaagaggacggaggtccgtctatcaactccatcaagccatcacttacggacaagaataaaatcgagagacttcggtattgtgccaataaagtaagg
ccaaatggtctattcgacgatatgcacaacgttgtgcacattaatatgaagtggttctcgctacctcgagacaagaagacgagggttatgttcatggcgg
cggtggcgaggccgcaatgggatccgcacaagaacgagtactttggtggcaaaataggcacgtggccattcgtacgagaagaaatacaagatggagatat
gaagccatcgcagcaaaattcagacaggacttttgttccgttggagaccgtgacaaaagaggacgtacaacgcatgatcacagagttaattgtccctgcc
attcgagacaaaatgcccgtacacctcatgcaaggacccatctacattcagcaagacagtgccaaggttcgttgctgtggtgatgcgctgtttgctgaag
aaggacggaaggatggttggggtattcagatgcagaacctcccgccgtattccccggactttactgtgatggatatcgctctcttcaaggccattcacac
agcattaaaagcattgccacctccttcggtcagtgcgccggtatcagggcttacagaactggtatcaggtgtggaacgggcgttcgcgtcgttgactagt
gaccagatcaacaacgcgtttttgtcgttgcaaaaggcgatggaatgtacgatgcgagtccaaggctccaacacgtacgagcttggacctacgggcagag
aacaacttcagttgcagggaagtttacctataagtattttgtgcgatccagatgccatgttggcgtgcagagcggcgcttgatggtgtaaccgaggaagt
cctcgagccgctttaataacaagagatcgcatcagca