Description :
Non Conding Region
Location :
Scaffold_1:86873- 87462
Sequence
589 bases(100 bases per row)
GTATGAAAATAAAGCCACACAAAGGGATGGCTCAGCTTCGCCTTTTATCTTCAGTCTCTCACAGTTCCGATCACTCCAAGTTTCCCCACTTTTAGTGGGA
AACTTAATGTACCTCCCACGAACTAGAGCGTACGCGTGGGGCTCTCGCAGTAGCCTCTTCAGCCTTTAACATGGGAGACGTTTGTGTACTATTCCCCAGG
AGACCCTAAAAACGAGTGAGACCGTGGAGCTTTAGCGTCCACTCGCTGAAATAGGACCGTAAAACGTAGCATATTAATGGGGTTTCCTCACTTGAACTCG
AGACTAGCAACACGTTCTCATCCTCGCCATCCACAGCTAATAGTAAAGCACAGACCCATACACATCCATCCACACACACACACACACACACACACACACA
CACACACACACCAGCATTTACGCCGCCTTCCTTCCGCCTTCTAGAAAATGCTCCTCTCTTCAAATCGCAGCGTGTCATTATCCTTCTTCATTGGCTAAAA
CCCCACCCAAATACCAGCCAATCACGATCCATTGTGTATGTGGCCAAGCCGGCTCCGCCGCACATTCAAATCTTCCAGGAAGCGCATCA