Description :
Non Conding Region
Location :
contig_1:86733- 91111
Sequence
4378 bases(100 bases per row)
GTTGCGTCGGTAGGTTTGGTACTCAACTTGCTTGGTCGGAGGCAAATCGCGTTGTGAAGGCAGCAAGGTTCATCTCAAAGTGGCGTGACTTGATCCGAGA
TTTCCAAGTTCTCGCTGACGTAGCGCTGCACTTCAATCTATCACCACGATTGAAGCGTGGCTGTGTTTTCCCAGCAAGTTATGTTTGTTTCTGTGGTTGG
TCATTGGTATCTGCATCACGAGTTTGCATGCAGAAGAGAGACTTCTGTCGTTTTGAGCCGTAGCATCCCTGGTCGTGTTAAAATTGAAATAAATGATGAA
ATTGCTCAAATCGATCGAGCAGAGTCAAAACTATGGACTCAGCTGAGGCTTGTGATGTCGCTGGTAGAAAACACTTTTGAGTCCCAGGGTGCACAAGGTC
GTACCGTGAAGGAAAAAACGTTTTAAGAGAATCGATCCAGCAACACAACCCTGAAAGGTTCGCCACCCCGTTCTTGCCGGCGATAGTCGTCCACCATTGG
TAAATAAAACTATCTCGGCACTCTTTCACTGGACTTTCATCGGATGAGTACAAGTTATCGATCCCACTTCCCCATTCATGATGGCGAGCCTCTCTTCTTC
CTTCTTTTGCCGCCGATCCACGTTGTCGTACTTGGAATAGTCTATGCGAATCGTTCGTTGGCGACGCACTAGAGTATGGAAGTAACCTTCTAACGCGATA
CCCTCTCAGTATGGCAACAGACAGAGCCTCACAGATAAGGCAGCCTCATTCGTCACTTCAAAGCGCCTTGGGGTTGCCAAGAGTCTGAAGCTATTGAACC
ACATCAATTCTTGAGTTCACGCCGATTCAAACCGTCGATGCAGGGCCAGAAGACACCCTTGTTGTCAATCCACTCGTAGTACTCGCCTTCGTAGAATAAG
CGCGTGACTGGTTCGCTAAGCTCACCGTCAAACTTACGGAACCACACGACTCTTGCCTGTCCCTAGACTCCAGCTGGTCCTCCAACTTGCCACAGTCGAT
CTTCTCTTTGAAACGTTTGATATTCTCCAGCACGTAGAACTTGGGACCAGTGAAGCTCACGATGTCATTGATCGCTTGGATGTCCTTCACTTGGCCACAA
TCCCCATCTGTCCATTCAAACATGTGCAGGAAATCTCCTTCCTCTGGCAATATGCCACGATTCACACAATGTTTTAACAGGCCTGCAAGGCTTCAGTTTG
GTTCTGGGGTCGCGTCGGTGGCAGCAGCTCTCGGTCATTTTGTGGTCGTTGAAACCTCCACCAGCACGTGAATCTGCTCCGACTCGGGCGCAGCAAGCTT
CTTTTTCAGCATCAAAGTCTCCATCGTACGACTTACCTTCAACGGCTTTTCCTGGAGTAAAGCCTCGATATCGTGTGTGTGTTTTCCCGTTCCAGTTCCG
TTGTGGCTTTATCGTCATCCGGTAGCTACTTGGCGCCTTTCGTGGCGAACCACAACTTCAGTTCATCTGGTTCGCACGTGATTGTTTGGGGCTTCTTCCT
CATATTGAAGAGACCCACCAAATCTGTCAGCTTGCTTTCACGATGAAAGGGCTGCCCTTATTTTCCAGCTGCGAGCAGACAACGCTTCTTCTTGTCTTCT
CTTTCACTCCCAACACCGTTTGGAACTGAGCACAACATATTTCTATCACTTTGCCCCAGTCACTTCGGATGCCCAAGTTAGCCGAAGTCTCCAAATAGGG
TGACCAGCTTGGTCATTCATGACCTTCTCCATCATTTTCCCACCTCGTTCTCAGTGACAATGGCATCTACGTTCGCTATGAGTCCGATCCAGCACCCACG
GGCCAGATTCTCGGAACGGGGCCATTGATCCACTCGCTATCGGTGCAGCCCGGAGACGACGAAAAGAGACTGTGAACGAGCGGTGGAGCATATTCTGAGA
GGGGCGTTGCAAGACGCTGAGGAAGAAGCGCTGCAAGACCGAGAAGGAGGTCCTGAAACACGTGGGCGAGCATTGCAGCGGTCCCGTCAATTGGCCTCTC
TGTACACAACGTCGACGGATAGCAAGTTCCTTCGCTCTCGATCAAAACGAGATGCCTCCATTCAGCGGTGCAACGAGGTGAAGGCTCAACGAGACTCCGA
GTCGTCTGTACGACGTGCCAGGTCAAGAGTGGGGTCAGATTATACACCAAGTGTGATCGGAGAGGGTAACGAGAGCGAAGAAAGTGACGACGACTCAGTA
TCGCAGTGTCGGTTAGAGCTGGCATCGCCCATCAAGCAGGGTGTGAGCTGGGGTGGAGCGTCTTCTCCATCCCCAGTCTCTCCAATCTCAATGGTAAAGC
CAGCAAAACCATGGTACGGCTGTACTGCAGCAACGTTGAAGGAGCAGGTACCCCTGGGCGTCACACTTGACGCTAAACTGCGTCGATATGGAGCCCGAGG
TACAGCGAAGCTTTTGCACGGGTGGCGATCTCAAGAAGCGTTGGGACCGCTATCTCCCATTCCGCTGGTTGCATCTGTCGATACATTTGTGTCAGGGTTG
AGCGGCTCACCTTCGTTATGGCCACCTGAAGCCTTCCACCCGACCGGGTCCAACCTACGCGTTACGATGACTCGTTGTCCTTCGTCTCCAATCGCAGTCT
CTGTGGAAGTTCCTACCTCCGTTGATGATCAGAGCTCCAATCGAGTGGACTGTCAAACGCACACGGAGACGCAAAAAGGTTTACAGCAAAAGGCAAGACA
AAAGCTTCGAAGCACCTACAACCGAGAAGTGCAGGTCGAACGGGAGGAACGCTTGGAAAACCAGCGAGATCTCGCTCAGTGGCAAAGCCGCACTCTTCAT
TTTGTCCCATCCTCTGAGCTCGCTGCGCATCGAGAACAGCAAAAAGGGGACCCGCATCTTCGCCATCGACGTACCCAAGCCTCGGCCATAGTGCAGACAC
CAGGGTATTCACCTGAGAAGCAGCGCAGCAAAGAGTCCAGAGACTTGAAGGGCAAGCGGTTCAAGCTGCGTTGGCGCTCATTTTCAAAGTTGCTTGACGT
AATGCGACGAACGCCTTGTCGAAGGCCTGTGCTACAAGATATGGAGAAATTATTCGCCTTGTCCAGGGAGCTGTGCGCGCTCAATGCGCTCGGAACGTGC
ATGCTCTCGCGAGCTCAATTCATGCTGCTCATCACGAGGGAGTTCCCTTTGTGTGATGCCAAGCACGTGAATCGCTTGTATTCGTCGTACGACTGGCAAA
TCTGTGACTCAGTAGATGCTCGATTCGTTCTTGGGACGATGAGAGCAATGCGTGTGCAACAAGGTGAGCCGATAGAGCTCATCTGCAACACGCTCCGTGA
TTTTGACGACACCACCGCCGCCAACACAAAACTTTCAGATGACAAAGCTGTGGTCTCGAACGGTGTTTGTTTAGCGAAGGCTCTGTCGCTTTGTTGTACC
AGTGATGAGGAAGAGCGCGAAATGGAGAGCAGAGCCGACCTCATTTGGACCAAACACTTGCCTGGCAACGACAAATTCTGTCGCGACGTCTGCGCGGCGG
TGTCCGACTCAATGTTTGGAAAGCATCAGGGATGTCGCTTTCGCGGGTCTCAAGCTCTGATAATTGCAGCCAAGATGCCGGCGTAGCGAGCAAAGTAAGA
GACTGTGAGACCAAGGAAGACGATGGCGAGGAGGACGTAGAGGACAGCAAGGAGAACTTCCTGAGCTCAGCCAACTAGTAGATGAATCTCGCGTACCTGT
GCGGCGTATCCGTGAGGCTCTCAAGCGAGAGCGAGAGACGCTGACAATCTTCACTCAACAACTTCTCCAACGCAGGCACGAGTGTCTTGTTGGTGCCAGC
ACGAGTTCTCCGAGGCAGTAATCTCACGTGTTTTGGTTTCACGAATCAACATCCTTTGCATCTTTTTATTCACGTCTCGACGATTGATCTTTGCAAAGAG
AAGGAGGCTATGATCGATAACTGCGTTGATTATTAGCATGACGACATTGTCCGTGCAGTTTTCATGCGCATTTATCACTTAGATTTACCTGCCGACGTCC
TGAGCCTCGAACACGAAATACGGCGCCGACACCATAATCTGCATGCGTAGTACGGAGTTGCCGAGTGTGCGAGGCGAACACAACCGGTGTCTACATTGAA
CACACCTGCGAAATCTCCCAACGTAGGAGAAAGCAGCACACAACCATGCTCGTTGCCGCAACATAGCAACTTCAATCACTTCGAGCGCAACATAAGTTAC
AGCAAACACTAGCTGTTACGGTTCCTAATGGCACTAATCACAAAGAGTGACGACACGTCAAGAAAAAATCTGCTTGAAACTGGCAGGAAGCGTGCGGGTG
GTCGCCATTTCAAGGTCAAAGTCTCACTTGGCGTCGGCAAGACTTACCGAACGAGAAGTTCCATATCCACACACAAGA