Description :
Non Conding Region
Location :
scaffold_1:86724- 95082
Sequence
8358 bases(100 bases per row)
CCCTCGTTTCAATTTCTAACCAatttgatgattttttttttgcttcatttgttttcaaaattCTTCTAGCTGGTGGTAAATTTTTCTTTATATTTTCTGT
GCTTTCGAAACTCATCAATTTACTGAGATTTTAAAGTAATATACTATGTCAATTGACTAGCACAATGAACAGTTTGAAATAATAGAAATCGAGTGCAAAA
TTTATCATATCTTAGACATAtcgacaaatttgataatgAAGGAAAGTGAGGCGATATGTTAATTTTTCTCTGTCAAGAACATTAAATGCTTAGTAACATA
GTACGTACTGAAATACAATGTGGTACCTTGCACACTGACTCTTACACATAATGCAAAGTTCACTTTATCCATTGTTGTTTATCTCCTTCTATTGTAAAGT
CTATAGCACCGTTTCGTGCTACCAGCTTTGGGCATATATGTCGACTTAAAGTAGCTTCAACTACGTAGAAGCAATCAAAATAGCGCAGTCATCTCAACCA
CTAAGAATGTGCTATTTTTTTGTGCCTTAAAAAGAATGCAAACCGTATCTGAGCATCACACAAGCAATCACTCATTCCTCATTTGCCTAACATGCGGCAT
ATTCCGTTGAAATATTGTAAGAGTCGTGCGATATGTGAATAAAAAAACTCATTGTATTACCTCGATCTGATTGCTATCTGCGATACGCCGTCAAAGCACA
TGAACAATTTAGTTTGCTACAGCTTCATCGCTGCAATTGCGAATAAAAGATGATAAGCGATGAAGGGCTGCAGCAGTCGTGAGAAAAAGCAGCAATACAA
ATTGTCAGCTGTGGGATTTGAACCTACGCGCTGAACGAAACATCTCAGACCACACGGGCAAACTGACGGGCTGGGTACATAACAAATTATGCACATGCAT
TATCAAGACATACCATGCAGATATGCCTACATGCTCTGGCAGACAGCTTGACGAGCTGCCNNNNNNNNNNTGCggcaagatgaaccatcgtGCTCAAACG
GCTCACAGAACCACTTCATCCGTGTTGCTtgtcgagtccttcggcaagccaaactcaaagtccGTACTCATGGTCCGCCAACATCCGGtgggtaccggca
aacttGGTCAGCAGCgccaccgcattcggagagagtttcaccctctgacagtctcacacgtgcgcacatatgtactcgtccacttgtacagcttgggcca
ccaatagtggcaacacaCCGAAAAGCACGTCTTCTCATGACCATGATGTCCACTAAGTGGGGTGTcttgggcctcatagagaatatgGTAGTTGAAATCT
ACATCGTGAGGGACCACACTTCGTAACGTATCCGTTtgatcggtgctataatacagcgacccgttattcaacaaatttcGATGTAATCATGcgtgcaaac
gcgccgactatttcttgtccgagtttccaaattcCTCGGTCATGAAAGCCTGTTGcagtgctacacacatattGTCACCAGCGTATGCTGCGCGGATCAA
CTCCGtcgctgacgacgtcaccgtcatgacctgagcaagctcatagtccggtctgcgtgaaaacgcatcagccgaagcattctgctttctggCTTATAGT
TCAtcttgaagttatattctgcaacgAATGAGagtcacctggccatcctctgtgagaggtgAGGACTgaatcgcagtgcgtaatgacgcgtgatctgtgt
agatcagaAACggtttgagccaagcaagtGCACCTTgaattgacaagtgcatacttcatcgcgagtaatttcttgttgtggactgggtagtttctCTCCG
CAGCCGTAAGATGGCCAGATTCGAACGTGATGACCCGATGTTGCtctgcgtctgcttgcagcagtgtgcagccgatggcaaagtccaaagcacTTCAGAC
AACACTAAAAAGACGATtaggggtctggcaacgccggTAATGCTACATGAATttggctgtctttgaccctgtcaattgcctcccgatgctcggtatcTCA
ACAGCACTtcttatccttcttaaggagattagacGAcgaccgtgccatttccccataatttgcgctattctTGTGAAAGTAGTTGgccaggccaagccac
ttgcgcaagtccttttggttctctggaatcggccagtctacaatggctttgacctcagtgggatctgctcgaagaccactcttcccaataaagcatcCTG
AACAGagaatttcttcagcgccgatgatgcacttatcggcattagcatacagcttatttgtccgcatgcactcgagcatagTTCTCCAATagatgatgtg
gttttccgcATCCTTCCGTGCCCCACAGGACTGCGGACaacgatgtcgtcgaaaaacatctgtgcatacgcccgatgaaGCCCaatcaattgcgtcacaa
gacgattcaatgttgctggtgcatatGACAGCTCtttgggcatcaccagccactccaagagtatccagctcggagtactcaccatTGTCAggggaatatc
actcgctctcatgaggaattggtaataattatCAgcaaagtcgagtgcgctgtaccaTGTACAGCCAgctatattgttctggagagcCGCCTTCCTAGAA
ATCGACTTTGCTGAAATGGTGGCAGTATTTAGCTTATCAttagcgtgaacgatacgccacttgtcgttcggcttccggacacaaagcgTTGGTGTCGAAT
gaagagacttgctctcacgcactaatcctgcgtcgtgcttcacacATAAcaaggcatcaatgacgcCACACTGCTGTTTGGGCAAGGGCCATTGTCTTGT
TACGCAgaatttggttcccgaaacccatttaatctcatgatgcacacctcggtcagGAGGTAGGAAcgatggcgggtctttggagatgaggttttaaaat
tcctttaccaagggATGATACGGATTCGAGGGATActtcaggatcgatgatatacttcgtgcgttcaacaCCCtgttagtgtcctccaggacagctttat
ccagaagcgacgacgagttaatctcctcgttcggtctaataatgaccacctcgacttgatcgcctgccttcaaggcaccgctatACGCTTCGAagggcat
ctcgtccagctcaagaagagcatccacggcgggaatagcctcgaggttgAAgtcaccgtcttcctctccgtcaaaccgttgacgaggttatatagctgtg
cgatgtcatctacggtagacacaccctgggtcagggtcgatgccctgcgtcttgcagatatcatacggctttgccgtaTACTCTCTATAGAGGATTTACG
TcgcatcgagaccagtgggagcacgcactcggcgtcgttcAGTGTCCCCAATTCCTTCTCCATCGGAGCCATAATATAAATAACAACATCCGAGAAAAAG
CTGCTATTTTGGagccttcgtccagtggatagcgtgctactccacgcgTATCAcaaggcctcgccctcgatgcctcggaacTCATCCGGTCATACCACTC
TTGGCGTTCAGTAACTGCTTTGtaatgtgagcagtgcttagtgggtcacgtgccacttcacgtgtatcactggggccttgccctcgatgactcggccctt
ggccgactatgccactcttgggatgcagcgactgtttcaattttgagcagtgctgagtgagttacgtgccactccgcgttcagcccgcgagctacTCTCG
CGACTCCTGTCCAGAACACATTTGGTATTtaacaactcggatactccgccATCcaacacattgaccgtcccgatcCCGTGCCAGTGCCAGCGCCAACAGc
gtttctgcttcctagcagaggtgggttcatgactcaccaaagttcCACCAGGAAATGTGCGTGTAGCGcataaggtcttcgacctccaaccaatccatgg
ctcatggtgttccagccatgccataccaaggctaacttcataccttgcatccaagtctaagcctagacagcattccacgctatcaaatcaAGTAacttga
catcgaggtcCACGAGGAccttcggcacagtgacacaagtttccgtcgctaagcgaataaTGActatgacgatgtcactcgaTTTTCTTTGATCGTGGAG
CATCgaacataattgcccgacgtcccggaatcgatgtCGATTTTCCatagcttttcaaagcccttcacggtcgcttttacgaccagcaagcccgacttgc
acacacattccgtgttcaagtgcacgcagctcttcggggctgggccttgctgccctctaccttgttaaggctcaacagaactcagtttacCCTTAGTAGG
GCGCCACACGCCTACGGAGTGCTCTCGTTCCCCAGCGTCAAAttagactggttagaagcgggccGTCAATTCaacgaaccttgacgcgccttgcgcaaga
gACAACCACGGGAGTCTGcacaaaggaagctaagctaagctcacCGACCTTGCGTTTTtaacaagaaccagtacgagtgtagcggatcgcaatacgcTAG
CTCCTAGAGTACCccaaaccttaaccaagacaAACACACTCTTCAGGtcaaaaattgaaactgtaaataATTGTTTTATTAGCGGcggagccgccaatat
cttaaTCCTTAGATTACTTGATtaaatagcaaaacctaattaatatgcataacaaTCGGAAATTCTGCCAcgcagtggcttcttgttactaGGgtttgta
gccacaccactgtatgattacaccaaattgtgtaatacacacctatgtacggtcgcatcatcttgtgcgacccgctctttcatacaagggtacgagtaac
cccgttacactctcccacagagcgcggtagaaAATCTTAGCGATTCTTCCTAAAGTTCACATTTTAAACAAGCTGTTCATTTAGTCGATGGCTCAGAATG
GTCATTCGATGTCGTCTCTTACGCTTTAATCTTTGCAATAAGCTGCTCTTTACTCCAAGAAGGCATAGACGCATAATGGCGTCGACGTCTCatcagctcc
aagctgctaAAAAAGACAACATTTTTCATGACAAAAGCCACTTACAATGCAGTATGCTCTCGTCAAATTCAGTAtacacctgcttggccctaagcctttt
gtgatctatagaGATCATGCATCGTTGCGCATCGTGACGCCATTATCACATCAATCACATAAAGTAGCACGATGTTCATGCCGAGAGTACCTTTGCGGTT
AGGTGTATGGCAGGTTGGCTGTTGTGGCGGATGCACTTTCGCGTCGCGCAGACTATGAATTGTTGCATGTCACAATTGTGGTATCGCCACTCGATAAGGC
GATGCGTACGACGGATGGGTTATACACAATTTGCATTGCGCTGCCGAAAGCCCTGAAATTAATCACTAAGATATCGCTTCATCGAGGCGCACTTTTGCAC
GCCTGCACTGCTGGGCCCTATAGTAAGGTTTGCTGCATCACAACACTGGTCCAAATGACACCCAGCCTGTAGtggctgcagcggggctgccgtagctcat
tcgcttaaaggaagctaagctaagattggtgaccttcgttatatactaagaaccagtacgagtgtagcgggttacaatccgcttactccaagagtaacca
caatcttgacccaaggcaaacaaagTCTTCCATGCAAAATGTAGACTGCATTTTTGTggctttatttgcggcaaactCATCAAAATTTAAAGCTGTAGTT
TTtcgattaaatagtaaaatctaaataaaaTGCATATCTGGCAGTCCAACcatgtactgacttcttgttatggtgtggccacaccattgtgtgattacac
cggcTTATGTAACCGACACCCTTTtatagtcacaccatcttctgTGACCCAGCCTTTAATACCAGGGTGCGTGTATCCCGGTCAAGGTGGTTTCTCATGA
CGAAGACTACATTGAAAGACTAATGCTCGAGGCACATGTCTCGTTTACCACCTCGGAGGATGAAAGACATACTGCTCGGTTCGCACTATGTGTTGGTGGA
CAAACGTGTATAAGTGGGTAAGCATATATGTTTGCACGTGAGAATCGTAAATTTTCCCCGTTTGCGGTAGCATATTTGGCCAGTCTACCACTTTTGGCAA
AGTGCTGGCGTTCATCAGTATGGACTATTTAGGGCTCTCAGGAGACGCGTCCAGCAATAAAACGTCTGTGCAAAATGACTGATGTCAGCGATAATATGAG
CGTTAAGGCTACAGCCAAGCTGTTCTTCGACAAAGTGCCTCGCTAATATTAGCTTGTTGATAGCCCCTGTATCGGACATAGATCCGCATTTTACAGCGAG
CTTCTAGTAAACAACTTAAATGCGCTTGAATCCAatttggatatgtcaacTGCTGACCATTCGCAAACAGATGAACGAAACGCGTAATTTGCGTTGTCAA
AAAATTTTCATTGGAGCACTTACATGGAGAGAGTGGTGCTGAAGCGGGCTCTTGCTCTCAATCAATTTTGCGCTGAATAATGTAGTGTAGGCCTCTACAG
GCTTTGTCTCGTTTCATACTGATAATTTGACACCGCAATGAAGTGGCCCAGTCTTATTGGAGGAGGAATTGTCGATCAGAATCAACTTGctgatatgcct
ggttacaAATCGCATTAAAATTAATGAGTTCAGCTCAATAAGATCAAGCGTCATGCATAGGACATGCGATGCTACGGCTGAGAGCCGATACAAACAGATG
CAACACGCCAATAACATAGGCAGGCGGAACACACgtgaatatattttgggAGCATAAGTGTTATCGAGCTCCATCAGCCCATTTATGTATACGCTGTCTG
CGGTTTGGGAGCAAGTTACGACCACACTACACCAGGCCGTTCACGATCGTAGCGAATAAGCGATGAGATACTTGCAAAGTCCTGAAGCGACTGTAAACTT
ATTCAACTCCTTAAAGGCAGTACTGAGGCTCTTCACAACCCCGCCCTTTCGAACCACTCGGACTTTAAGAGCCCTATTGCAGACGAATTGACGTCTCCAC
CCCCTATAGCCAGCTATCCATTGCTTTTACTATGGAGAGGTACCGAGATCGCTTACGGTCTGTCGCACCTTCGGTCTTTACAATCCTTCGAGAAAGGTCA
GGGTCGATCGTCGCAGCGGACTCCCAACTTGTAGAAAGCAATGGGGTTCGTGGTCACATAGACCCTTGGTTGGCAGCAATTACACCTTTTTCATGGGATT
GGGCAGTGCTGTTAACATCAGGAACTTAAGGCGATGGGTTGTCACTTGGCGTTCTCGGTATGAGCGGAAGGACCGCACGTATGAGCACGAAGGAGCTCGG
CTCTAGTGCTGCGAGCAACCTTGAGCGACTTAGAAGCTTTTAATGACGACGTTATTTGACAACAGTGAGAGTAGCATTTGCGTTTGCAGTTAAGCAAGCT
GGACGACTTTAGCCAGTTTCAGTTCATCTGGACATTATCGTGAGCTCTAATGCGGGGTGTCAGAACACTTTTCGCCGATGGAAATGGACACGAAGCCCGa
gcttggtgtcctccaaaacagcttcatccagaactTGTGTGGCGCAGTGAGAATCTTCTCGCTTGGCCGTTTGCTGCCGAGTGAGGTTGGAGATATCGGG
CAGGACTCAGAAAGTCATTGGGACCATTCTCATCGGAGAATACCTCGGCCAACTCACCAAGAATTCCTTAAGCGCGTCCGCCGCAAAGACCACGCTATTA
CGGAGGCTCGTTTAGCCATTAATTTAATGCACAGGTGTAGACTTCCGGTGTAAGAACACTCAGAAGCAGAGAGTGGAGTAAGACTGCAGGGACAGTGGTA
GATCTTAGAAAGCTCATTTTTTGCGTAGGGTTCTTTAGAAGACAAAATAAATGGGAAAGCTGGCCTAAGCGGGTGAGAGTACTGTAGTTTTGTGTACATA
ATCTCACGTATTCAATACAATTGTATTGATAGCACTACGGTACAACTGTACAAAATTCACAATTATTAGATACAATTAGTTTCATCATTTAAAAGTACCA
TCGTAACGACATTCCACTCCAAAAAAGAAGCGGCCTGAGGTTCATTGTGGGCTGCTAACCGCACTCAGAGAAAAGATAGTTGATCCTGAGAAATAATAAA
ACGCATAATCATTATTGGTCTAACTAGAACTTATTTTCGGTTGTAATAGTAAAGCAAACTATTGAAAGCCATTGAGTCTGCGGAATTTAGACCAATCGAA
CCTCTGCTAATTAAATTATTTCAGGGCCAAAAATTAGGGTCAATATTTGCAGAGTAAGATATGCATACAATACGAGTATGATTGCAAAATATGTGATTAA
CAGTTAGTATCTTCCACTACTCATTCGAGAATCTGCTTCATAGACCTCACAAAAGCCA