Description :
Non Conding Region
Location :
Scaffold_1:86609- 88327
Sequence
1718 bases(100 bases per row)
GCTGGAACGTTGTGTTGTGCATAATGGGCAAGCTAATTGAGCGAGGCACATCATTAGAATAAGCCTGAGAAAAGCGATAACAAAAATGCTGACTTTGGGG
CAGGTGAAATGGATATTCACTAAACTTTGGAGGTTTTTGGCTCCAATCAAGTCGATCTTGCTCTGTTTTCTCACTAATGAGTGAGCTCCATCAGCACCAA
TGATATAATTTGCAGAGCAGTGTTCATATTCTGTGCTTGTTCCTACACTAACATAATAAACGCATGAACTTCCCCAAGGAAATCTATTCATTGCTTCCTA
CCGTGAAAGATGCCGTAACTTCACCTGGGGTAGCTGCTCCGGTGTACTAGAAGGCCTCAGGTCCACTAGCTCAACGCCACGTTCTACTTCCACTTTTTTA
TCACGTAAAAATTCGCTCAACAATTGCTCAAACTGATTCTGTGGAAAATGAACAAATTTGGTCGGTGATAGCATGCTGCTAAGATCCTGCCTTGTCGCTG
CTGACATGTGCGACTTCGGGATCTGATCAATAGATGCAAAAACATGCATTTTCTGCACTTTACTGCAGTACACGTAATCCTTCCACTGATTGAGATTGAC
AATGCAGTCAGCCGCTTGCGCGCATCATCATGATCACCACTTACCATTAGAGCTGGTGCGGCTAGTTCGCGAACACGATGATGGAATTCTGGAATCAAGG
AATACAGTATCTCCATTGTACGCAGGTTTATGAAATGTGCCTGAGGATGAGTGGTTGGACGCATCTGTCTCTCGATTACGCGAACGGGTATTGAGAATAT
TTCTTGGCATAGATAGGCAAAGACAGAGCCAACAGGTCCACCGCCGACTACCAACACATTTTCTTTTGAAAATAGATGAGTAAAACGACGTTGCGCAACA
CCCCGGCATTTTAAAGCAACAGTGACCGGAAGATGAAGTCGCATGTTCATTGAGTAGCTGTCTGATTCGCTGATTGGTCAAGTGCGTAGCTGTTACTCAT
AGCGTGCATCGAAAGCTGCGCCAAATTAAATTCACAGAAATATAAAAAGCGATCGAATTCGACAGAAAGAAACAACAACGCTGTCAGAAAGATCGCAGTG
TCATCAATTTAATCCGATAACATCGACATATTCATGACGGTTAATCTATTCTATCGTACACTCTCATCAAATTGTTTCATTAAAGCTCTGCCGTGACGAA
ACAATTGCAGGTGAGTCTTATATCACATATAACGCAATGGAAAATTCCCCCTCTTAACAACGACCCGAATTAAAATAGATATTGCAAGATCGATGTACGT
GATAGAGATCCATCGGATGAACAGGCCTTTATAAAGCGCAGTTATTTTCACATCGATTATTACACATTTCGAGCGTGAGGTGCGGCAGAAATTTTCAACC
CTTTTCATTTCATGTGTGATTTACGCATACAGAACAGAATCGTCGAATGGTCATTATACTTTGCTCGTGAGCCGATTACTTTATGCATCTGCATGTGGAG
CATGCCCCGACACCGCATAGTGTTATCCACAGCATGGCTTGATCGCAGCGGTCGTACAATGGCCAAATTGAGGAAAGAACGTACTTTGAAAAGTATATTT
GTGGAAGACAGTTTTTTCTAAATGGCGAGATGAAGATTGGACAGAGTCGTGCGTGCTGTACTACATCAATAGCAATCAACTATATTGCCTTCGTGACACC
GCTTCAGGCATATTGCTC