Description :
Non Conding Region
Location :
Scaffold_1:86154- 86708
Sequence
554 bases(100 bases per row)
CCAGCAAAACCAAGTGCGGTCGCCGAACGAGTCTGCTTTCCTTGCACGTCGTGCTATTTGAGACGATGACGAACCGAGTGCAAGCGCGAGGGACGAAGTG
AACCGACAGCACTGCTGTAATAGAGATAGAAACAACCCCCCCCCGCAATGGatcggagctcctcgagcgCGAGGAAGCGGCAGACAAGTGTTTTATGCCG
TCGGCTTGGGAACGTAACCTTCCTCCCAGCCAGTTTTGATCGAGCTAAAAGGAAGGATTGAGCAAAAACAATATCCCCATGACCATCTTTTGTGTTGAGC
CTTGCTTTCTTCAGCCTTTGTTGGtccatgtacagtacagcGGCACCACCAAACATCTTGGTGTCTTGTGCGCGCAGAAGTCTGCAACCAACATCACCTC
CCCCTTCTCTTGCTTGTGCAAGCCCAGTCGCTTTCGGTGTGGGGCCAGTGTGCCTCGACGGGGCAATGCAGCGTCAAAGGCCGCAGCCACCTGGCTCAAA
GGCTCAACATGTTACAGTTCATCAGACTACACTGCTCTAATAACGGTTAAATCC