Description :
Non Conding Region
Location :
Scaffold_1:86099- 94947
Sequence
8848 bases(100 bases per row)
TTGGACGGTGGCGTAGGCGAATTGAGCTGAACAAGGCCAAAAGCGGAATGGAAGACATGGAACCAGACAAGGTCTCACGCTGGCAATTACTTCAAGTACA
TGTAAGAGTCTTCGTTGGCAACGACTCATAGCCAGCGTGAGGCCCCACGGTGGGGGTCTGGTCTCAGGAGATGCGCAGCAAATGATGGACGCTTCCTCCA
ACTAGCAAAAGCATGTGCACAGATGCATTTACAATTCATGTCCAAAATGTATCTAGCATTACAATTCCACATCAAATACATACTAGTATATGCTCACCCT
TTTGGGATGCACTACGAGCATTTAAATACCCAGTTGAGCCCGCGAGCTTACCATGTAGAATTGTGTGCGCATTAAAATCGACACCGTACCATGGAATTTC
TACTGACTCCGTACTTAGTGCTCGTTCCTTGCCGATCTTCAAGCGACGTATAACTGCTACATCCAATCGGTGGACGTTTGACCACAAAGTGGTTCCACAA
GTATCATTGTGCAGCCGGACCGTACAGTTCATCATGACAGTATTTCATGTGGCACGTTTTCATTGAGAACTTTTCAAACGTAGAAAGAAAGTGGGTTGGC
ATCGTGCAAAACTCGTCTACATGTTGAAGTGAAGTAGCAAAGATAAGACTGTGTTTTTTAACATGCACTTTTCAGATAATGTTTAAAATGTGCCAGAATA
TTGGTTATAGAATGCATGTACTGTAGAGTGATCTTGACAGGAGCTGTAAAACAAAATAAAATGGGGGTGGTTGAAGTTGCTTAGGGATGACAAAATCGAC
GTCATTGCTGATTAGGGATGACAGAACCGACGTCACATTTCTTCAACTAGAATCAGATTATCTGATTCAGATATGTTCTACAATTCCTCAGATTTGTTAA
ATACGATGGGAGTACAGGGCAACAAGGATCTATTGCATGTACATATAAAAATATGGTCTGGAGCTGGTATATCGTGATATTCGTCGTACTCGATAGGGTT
TGATTCTACGGTACTGCTAGACTTGCTTTTTTTTGTAACGTCCCTCAATAAACTATAGTACTATGTAACGAAACCAGAATGCGATATCACACGAAATGAC
ACCTATACATTGTGAAAGATTTTGTCTCTCACTGGCTTTCCATGTTCTATACTACATATTGTGCCTTCCACTTGTTTTGGCGGGTAGAGTGTTAATTCTG
CCGGAATTAGATTCATAAGAAGGCTGTCAGCACACGTTATATGCTAATTAAGCGTAAGATTGCGAACTCTTCCCCACCAACATGTTAGATTCAATAGGCG
GGGATACGCCTGGCTACAGCCGGGGTGGCGGCCAGCAACCCTCCAAACGCCTTAAAATCCATCTCACTCAGGCTTGATAATCTTATTCCGTCTTAAAGCA
GGCTCACCATCCCCTAAAACTGTCGGAAATGAGGCAACCCATAATTAACATGGAATTAGAAGACGATAGAGCATAATTAAGGCCGAGAGGGGGAAAATAA
TTATGCCAGAATAATTGCGGCAGAAAAACTGAAAGGCACAATATAAACTTAAATCGAGTTAAAGAGCTTGGCTAACACTCGAATATATTGGACAATAAAA
TTTAAATTGCAACAATATTTACTATTGCTTACTCAAAATTGAAATCTTTATTATTATTCCCAAAATACGATCTTAAACGGTATTGGCGGACCCTGCTTTA
CAACCCCGCCTCGACGCCCAAATTTACAGATCAATTTTGGTGCTACATGTATGATCGCGTGATTGATCAGCCGATATCAGCAGTACTACATCCAGTTAGA
GCCTTAATAAAGACAACTCAATAAATAGTAATAATAGGGAGAGGATAATCTAGGCGCGATTTGGCAATAGCATATTGATTTTGTACAGTAGTTTGCCTCA
ATAGCGAGATCATATAATTTTGTAACCCTTAACACAATGTTCGCAAATCTCTGATAGTTCATTTGTTTTCGTCCTGAACCACACCTCTATCACACAATTC
ACTTGAGAAACGAATACCAGTTCGGACTTCGCTAATGAGACGAATTACTGTATTTGATGCCGTTAGTCGGATAAAACTGACACTATCACCATGGTTATAG
ACTGATGATGTAGAGCACAGGCAAACGAAGAAAACCTTGGACAATGTAGACTTGAAATGAAGAAGTTTGGAAGGAAGGAAGATTTGCATTAGTGGAGCAG
CAAGCTAGACTCTCACTACTGTCTTCTTATTGTATACGGCAGTCAGAAACACTATTAAATAATGTCGCTACCAGGAATTTGTTTCGAGTCATGAGTACCG
TATCCCTTCACAATTAGTTTGTAAGAGTACGGTACTGAGGTTAGCTCTGTGACAAGCCCTAGATTCAACACTCTCCTAACTCGTCATCAGGGAATATTAC
CGGTGCAAAAGGTGACCCGCTTCCGATTGGCTTATGGTAAACCCTTTCAAAGTCTTCAGTCAGTTCACAAATGGCAACATGAGACCGTTTTCTTTTTTTG
TTTTTTTGAAGCTTCTGGAGGCCCTACGAGCGATCTGACACCGGATTCGGAGTCTCCTCGTCAGGTTCATTTTTCGAACCAAGCAGCAGATTGACCCGTG
CGGTTGACTTGCGCACTAGCGGACCTTTTGGAAATGAGCCCCCTAACCACATAGGATTTAGTTTTTGCAGGAATATGTTTTGGAGGTGTGACTTCAACAC
CAACTTCGGCTCAGAGAGCATCTTAGCAGCATATGCTGTTCTTATCAGGCAGAGGGGTGCATAGTTGTTATCTTTGTGCTAGATCTAATTGCAGTATTTA
GTTAATTCCAAGCCATATATTTAAGCGGCTAGTAATGCCAGTTGGTCTAGCCACTTTTAGCTATGCGTGAATGGCACAGGATGCCGTTTTCGCTTCACAC
AAGACTTTCAAGTCTCACTTTCACGTCATTATTGTCAACGACAAGCTTCTAGCTGCCACTGCAACATCTAAAGCAAGCCACCAGCGTTCAAGCAACAACT
TAGTCATCGACGCACCTATGGTCTGGCGGATTGGTCTGGGGCTCTCTTATCAAACGCCAGTTCCAGCGATCATGTCAAGGACAGCAATGGTTGCGCCAAT
TACACTAAGCAGAACAATACGGCTCGACATGCATTGCACCAAGTTTACAAGGCTATCGTCGTCTCTACCATCACTGAAAACGATTAACAGCCTGAAGCAA
CTCTCTACAACTTTCAGCAGTTCCATTACCAGCTATTGAGCTTACGTCGCCGCAACAGCTACCGTCAGGGCCCCCTACACCGGATTTTCTACCTCGACAG
TCGTCGCCGACAGCGCCAGGAGTTCCACCAACCGTGCAGGTTGGGGGAGTGGTCGAACTCGGCGCTCGCCCCAAAGTTTCGTGCCTGCAAGCCAGGTTTG
CGAGGAACTGGCTCACATCACGCATGTGATAGGCTAGATCAGGGCGCGTGCCGACCATGAGGTACATAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGGGGGGGGGATAACTATGCCAGAATAATTGCGGCAGAATAACTGAAAGGCACAATATAAACTTAA
ATCAGAGTTAAAGAGCTTGGCTAACACTCGAATATATTGGACAATAAAATTTAAATTGCAACAATATTTACTATTGCTTACTCAAAATTGAAATCTTTAA
TTATTATTCCAAAAACTACAATTTTAAACGGTATTGGCGGACCCTGCTTTACAACCCCGCCTCGACGCCCAAAATTACAGATCAATTTTGGTGCTACACG
TATGATCGCGTGATTGATCATCCGATATCAGCAGTACTACATCCAGTTAGAGCCTTAATAAAGACAACTCAATAAACAATAATAATATGGAGAGGATAAT
CTAGGCGCGATTTGGCAATAGCAGATTGATTTTGTACAGTAGTTTGCCTCAATAGCGAGGTCATATAATTTTATAACCCTTAACACAATGTCCGCAAATC
TCTGATAATTCATATGTTTTCGTATTGAATCACACCTCTATCACACAATTCACTTAAGAAACGAATACCAGTTCGGACTTCGCTAATGAGGCAAATTACT
GTATTTGATGCCGTTAGTCGGATAAACCTGACACTGTCATTATAGTTATAGACTGATGATGTAGAGCACAGGCGAAAGAAGAAAAACTTGGACAATGTAG
ACTTGAAATAAAGAAGTTAAAAAAGGAAGTAAGACTTGCATTAGTGGAGCAGCAAGCTAGACACTTACTACTGTCTTCTTATTTGTATACGGCAGTCAAA
AACACTATTAAATAATGTCGCTTATTGTCATTTGTTTTAGAGTCATGAGTGTCGTATCCCTTCACAATTAGTTTGTAAAGCGTACGGTACTGAGGTCAGC
TCTGTGACACGTCCTAGATTCAACACTCTCCTAACTCGTCATCAGGGAATATTATTGATGCAAAAGGTGACCGGCAACCGGTTGGCTCAAGAAAACCCCT
TCAAAGCGTTCATTCAGTTTGCAAAATGGCAACATGAGAGGTTTTCTTTTTGTTTTCTGAAGCTTCTGGACGCCCAACGAGCGATCTGACAACGGATTCG
GAGTCTCCTCGTCAGGTTCATTTTTCGAACCAAGCAGCAGATCGGCCAGTGCGGTCGACTTGCGCACCAGCGGACATATTTGGAAATGAGCCCCCTAATC
ATATAGGATTTATTTAGTTCAGGTATAATGTTTTGGAGGTGTGACTTCAACACTAACTTCGACTCAGAGAGCGTCTTAGCAGCATATGCTGTTCTTACCA
GGCAGAGGGGTGCATAGTTGTTAGCTTTGCGCTACATCTAATTGCAGTATTTAGTTAATTCCAAGTCATATATTTAAGCGGCTAGTAATGCCAGTTGGTC
TAGCCATTTTTAGCTATACGTAAATGGCACAGGATGCCGTTTTCGCTTCACATAAGACTTTCAAGTCTCACTTTCACGTCATGCACTTTCACATCGTCAA
CGACAAGCTTCTAGCTGCCACTACAACATCTAAAGCAAGCCACCAGTGTTCAAGCAACAACTTAGTCATCGACGCACCTATGGTCTGGTGGATTGGTCTG
GGGCTCTCTTATCAAACGCCAGTTCCAGCGATCATGTCAAGGACCGCAATGGTTGCACCAATTACACTTAGCAGAACAATACGGCTCGACATGCAGTGCA
CCAAGTCTACAAGGCTATCGTCGTCTCTACCGTCACTGAAAACGATTAACAGCGTGAAGCAACTCTCTACAACTTTCAGCAGTTCCATTACCAGGTATTG
AGCTTACGTCGCCGCAACAGCTACCGTCAGGGCCCCCCTACACCGGATTTTCTACCTCTGCAGTCGTCGCCGACAGCGCCAGGAGTTCCACCAACCGTGC
AGGTTGGGGGAGTGGTCGAACTCGGCGCTCACCACAAAGTTGCGTGCCTGCGATCCAGGGTTTGCGAGGAACTGGCTCACATCACGCATGTGATAGGCTA
GATCAGGGCGCGTGCCGACCATGAGGTACATAACACTACCAACAACTTCTCTATACGGTATGTATTTCATTTTGTCGTTCTCGTGTTGTGTCTGAGGCTT
CATTACAGTGGTGAGATTTACGTTACGGTCTGATGGCGTCGCAACTGGGTATATTATCAAGTGCTTGAACCAATCTAATACAGTAGTAGCATACTTGCGT
TGGTGGATAAAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGTTCAAGAACAAGACCCGTCCAAGATTCCACTGTCGCTGACACCCAAGACAGGTCTACGTACTCCTCCGACTAACGGTGCGGCTGAGCGCG
GTGCTTCTGGCACTACCGCAGCTTCACCTTGCTTTTAAGACTCTCACA