Description :
Non Conding Region
Location :
Scaffold_1:86098- 86614
Sequence
516 bases(100 bases per row)
tccaaaataagcttaattggagagattctcggtactaaggagaggagagacaatggataatacggtgtgctgtcttgctgggttgatatcctcctggggc
ttcacccacgcgccgtctaagatggattgaactccccactcctttgctattgccgcgtcttgtgaaacgacttgggatccaaccacgagcattctatgtt
ccaaacaccaaacatggattttaaaggtgaagaagggaatatggtgtgtacacatcacaattattaaatctagcagacatgacacgaagcaacacatgca
tgctggatgtcggagtcgctttcctcggctctgtggatgacgacagcctcgatgcaaattcaaacttcgcgcagcaccatttagactgaactcttgcaaa
cttattggtgcttgaatcgcagcgacatcctctgaatagcacacacagcagcagatctatcgaatctccatcgtgaagcatacgccgttccgtgtcttct
gccttgatcctgtatc