Description :
Non Conding Region
Location :
Scaffold_1:85969- 86544
Sequence
575 bases(100 bases per row)
GCTCTGTGCGGTCGCTTCCGGACGGAAGAGCGCTGGGTCGGCACGAGGAAAGCGGGGGCCTACTGGTCCTGGACGCTCGCAGGCGGCGCAGCAGCGAGGG
CGACGCGAAGAAAGCGCGGCGGCGGTCGATGAGCTGCTCGATGAGCTGCTCGATGAGCTGCTCGATCTGTCCGGCGGTCAAGGGAAAAGTCGGTGGCGGT
GACGCTGCCCACCAATGATTGGCCGTCGTGGTTAAATATCTCCATTTCGGCGAATGAGTTGTCGATATGCATACTTTACACCAATGGTGAACGTTCTCGT
TCTTGACACCATGTTTTAGTGGCTGAAAATGTTGAATAGGGTCTCGCGAATACAGGGTCGAGAACCGTCTCGTCAAAAGAGGGATCGAGCGGCATGAGAC
GTGACGCACGCGACGTCGATTCCGAACGTCATTCCCTCGCGAGTGTGCCCATTTTGCGGTGCGGCGTTCATCGCACAACTCAGACCAGCTTCTTCCCACC
TTTTCTCTTTCTCTCGACCGGCGGGGCTAGCTCGCTCGCTCGCTCGTTCGTTCGCTCGCTTGCTCGGTCCGACGA