Description :
Non Conding Region
Location :
Scaffold_1:85911- 88768
Sequence
2857 bases(100 bases per row)
CTGTCTGCCTATTTGGCCTTCTGCACTCGCTCGGCACTCCTGCTCTCGCTGCTTGCTTGCTGCTGGTTTCAAAGCAGGACAGGGCTGCAAAAGCAGAACC
CAGGACAACCACTCCGCACGCGGGTGGGCCGGGTCTGCGTGAGTGATGGTGCTTGCCACTCACCACGCACAGTCCCAGAAAAAGAGCGAGAACTGGGAGA
AAGAGAGAGGGAGAACAGATTGGAACGTTTGGCGCGAAAACCTCGGTTGTTTCAGTACTCTTGAGACAATGGTGAGTGCGAACTGAAGCCAGTAGCACTG
ATTTTGGTAGATCTCCGTTTGATTACGAGAAGAGGGCGGCTGCGGGAGCCTTTTTAGCCAATCCATGCAGAGAGAATGATGCAGGTCAACTTGATTTCAC
AATCAGCAAAGGTTTTTGACGAATCATGGCAGCTGTGTGCTGTTTTGGCCAATTGCAAAACGTCTGTCAATTAAACTGCTAAATTTGATATTTATCTGCA
ATGTCTTTACGGGGGGATATAATTAAAGAGGCATAAGTACTATATCGTTTTTTATAGATACGACTTGGGCTCCAATCTTGTCAATCCCTTCTTTCACAAG
CTGACGGAGCTTGAGTGGACACGAAGCTGGCAAAAGAGAGCCAAAGAGATTCGATTGATTTCCCCCTCAAAGCAAATCTTGAAGCGCCGCAATATTGCTG
CTCTTCTACATGCAGATCTGCATCCACACGCACAAAAAGATGGTGCCAGCGAACACACATTTCACTTGAATCAGGCTTCATACTGGACCGAAAGCGTCAT
GACAGCTTACACAAGAGAGAGCGTTGAGGCTTCAAGAGACTTTCGTTTCAGAGCTCTTGACACATTTTGTCCACTATACAGACAAGAGTCCGAACGACCC
TTGAGCGCCAACGTGCGTGTATTTTTCGTATTGTAATACGAACTTGCCTGAAGAACCACTCGTTTCTGATGCACACACATAATGGCGACAGAGCGCACGA
CTGAGCACCGCACGCATGCTCTGGTTTCGTGACCAACCACGTCAGTGATGGCGTCAATCGTCCACCAAACCCAGATTTGCGAAGTCCGCATTCTCTGGGA
CACTCACATTCATTTCATCAGACGGCACGAACAATGCGCCGAGAAACACCTGCTGCCGGAGCACGAGCACAACCGCACACAGAAATCAACTATCGAGTTG
CGTTATGCTGTGTCCCATGTGCGCGCGCATTCTCATTGAGAGCGGTAGCGTCAAATACAAGTCTGTTCGCCGAATTCGTTGGAGAGGATTGGGCTAAAAT
GCCAACCAAAAGACGCCGACCGTGTTGTGGAGAATGCGCAATTTTGTGAAAAGCGAGCCATGTGTGACTGTGTGACCTTCAATGTAGCCCTCTCAGCCAA
AAGTGTTCAAAAGTGTTGGACCCAGCCGCGCTGGGTGCACCTCCTCAACACACTCAGCATTCAGTTCGCCATGCGCCCATCCTCGAAATGTTGCAGCAAG
GATTCTCACCGTGTTTTGGGAATCCACAAATTACCGCTTGGATACAAAGTGATCGTTTCTACACCTTGATTTGGCATTTTTCTGCAAATGTGGCGGGTTG
ACCCAGCTGAGAGCCACTCCTTTTTCTTCGATTTTTGGGAGTTTAGAGGCACTTTTGTGCTTGGTCAACATTTTAGCGCGCGGCTGAAAATGAAGATCTT
GGTCACCTCCTTTCCATTTGGCTCGGTTTTGAGAAGAGGAGACGACTTTCTGACACGAACCCCTACCCGCGCCAAGATCCCAAAGGGTTACACGCCGTTC
CGCCCGTGTTCCCACCTCCCAATCTCATCCTCGCGTACAGAAACAGCAGGTGCTGGGGAATCTCGCTTCGCAGCACGGCTGCAAGAAGTTTGCAAAATTT
TGGGCATACTGAAACACATACAAAGTTCCAAGTTTCTGCGAAGCTCGGCTCTAAAAGTTCCACAAAATACTGAAATCATGGTTATGAGTGTGAACGAATG
GTGGCTGAATGCCAAAATTTGGGAGAAAACCAAACGATCAAAGCGGATTCGACTATTTTTCTCAACAAAAGAATCAAGTTTTGCCTAGTTTCTCCAAAGT
CTAAAAGTGCATCTAAACGAAGAAAGTGTATGTACCTGGGTTTACGACTTATTCGGCTCATTCACAGCCGCTCATTCGTCCGCATAATGTGCTGGATGCG
CAATCTCTATTCGATCTGAAACGGCCGCAGAACAGATTGTTCACAAGGAACACAGTGCCAGCCAGCCAACACTTCAAGAAGAAAAAGTAGTCAAACGCTG
GAATGACAAAAAAGTCAAAATGGCAAACCAGCCAGTCTCCATAACACAATATCCTCATACAAAATGCAAATGCAACGCAGTCAAAGCAGCGTGAACAAAG
GTGTCGTCCAGCGAACTTTTACAACTTTTCTCCTGCCGTTCTTCAAGACTTTGCGAGACCTCTACGTTTGACTCACACGATCGCTCTCTTTCTCTGATCC
GTGAAAAAGGCGCTCGCTCACTCACGGCTCTTTTCTGCCCACTGAAAGAGTGGTTGTCCCCTGTTTTGCACTCGCACCCTCATTGAGCAACGTTAGAGTC
TTTTGGGTTTGCTTTCTCTCGAAATGAGCAACTGGCGCTTTCCCTTGCCTCAAGGTTTCCCTTGAACCTCCATGGCCTTCGCGCATGCCCGCCCGTGTGT
GTGCCCGCCATGCCATGCCGTCGCGGCAGTCTCATTATTTCCGACCCACTCGTCCGCCGCAAGTGACCATTTCATCCACCTGCCAGGGCCAGTACCAACT
TCGACACCTTACAGGAAACCCCAAGAGCTCTCTCCCTGTTTATTGTCACAGACAAGA