Description :
Non Conding Region
Location :
Scaffold_1:8562- 8851
Sequence
289 bases(100 bases per row)
GTCGCCTCTGCCTTGCCTGGTGGTGCTCTTCTCTTTTGGAAATCTTTGCCGCCTGATTATAGAGCCACAAATGGCGGGAGCTGGCGCCACAAATAGCCAC
CTGCTTATTTGTGGCTCTTAATCGTGGCGATCCAATGTGGCCACCATTAATGCCGTTAATGCCGTTGATGCCGTTAACGCCAGTCTCGTGTGGACCACAC
GGTGTTGTGCCAAAAGCGTGTGGACCACGCAGAGTGGTGCCGAGACCAATCACCCCACCCCAGCACTAGATACCTGAGACCGACCACCA