Description :
Non Conding Region
Location :
contig_1:85565- 86274
Sequence
709 bases(100 bases per row)
TGCTTGACAGGTGTCGTCGTCGTCACCGATCTCCACTCGTTTCTGGGCACAAAAGCATGATTCTTAGACAGTGTATGAACGTGTAAACCCCCACGACGGG
TCTTCGAGTTGGAGCACGTTGTCGTCTGGCAGCAATGACAACTACTTGTGTATCGTCGCGGTTGACTTGGACACCTCGAAACTCAAGAGATGGAGAACTC
TTCGCCATGTCATCCACTGAAAACACACACCGCTCACTCTGCAACCGAACGAACGCAGACACCCTCAGCCCACGGCCGGCGAATTCTCGCGTACATATAT
TTCCATCGGAAGCCCCGCTGTCTGCCATCCTACGCTCGTTACTACTGCCTACATCCAAAGAATAGGAAGAGATGGCACTTCGTCCGTGCGGCTCCATTTG
CTGTTGTTGGCTCTGATGAACCTTACTGCTCTAGAGGAGACTGACATGAGCCGGAGCAACTGACTGCAACGTGCGGCCCGATAGTGTACACATTCGCGGG
TTGGGCCCTTGTTCTTGAATTCTTCAGGCCGCTCGTGAGCTTCCTCACTATTTTTTTTATCGGGCTCTGGTGCCGCTTGTACGTGGACTTCTCCGCCGTG
CGTGGTCCATTCGACTAAGTCGAGGCTGGAGGGTTGTGTCATTTTGCTGAGTGTTGTCTTGGTCGCTTACTTGATGTGCGTCTGTTGGTAGTTGTACGTT
CTATCCGTC