Description :
Non Conding Region
Location :
Scaffold_1:85482- 87608
Sequence
2126 bases(100 bases per row)
AGCTGCACAGTTGATGGGGCTTCCTTCACTTCCCACACGGCGTTTTTCAAACTGAGCCCTCTCCTATATTCATGCTTCAACAAACTAGGATACTGCACCT
AACGCCTATTTGGACTTAAACTCGGCAGTCCCAAAAAGTAGAATTAGGCACTATGGCATTTTCCAGTGGAAAACGATGGGCACGGAGGTGCGCGGCAGTG
TTCTCGGCAGGTTATTTGTTCGTAGGTTGACGATGGTCTCTACTGGTGATAGATTACGTTTTATGggtccttcttcatgaagctgcaggactaTACGGCT
ACCCGAGCTAGTAGAGGAGAACTTCGTGTTTTAGTTTCAAATACACCATAAACTTCCACTCTGCATTACAGGGCTATAGCTCGCAAACTGAAGAGGTTTA
GATTTGTATACAGCCGTGATAAACTTTAGCAGCGATTACAACTCGAGTGAATCGATAACCTTTGTCCGTTCGCGCAGACGCAGGCATGTTTATCCTGCTC
ACTTGCTAGTATTTTACCACGCGCGAAAAGGTGGCTGTCGCAACACTGCCACAACCGTGAATGAAATTGCGAGCGAGAGGACCACTCGAACGCTGTTAGC
ACAATGGAGCCATGCATCATTGCTTTCCCGAACGAGCTACACGAACGCGCAAACTTTGCGTACATCGGATCGAATCAACAGAAACTGAGATGAAGATTTT
TACGACGAGTTTCCGCTACAAACGCTCCGTCAATCACTCTCGCCATAACGTCTACTAGTATTGGGTTTATATACCTCTGTTGGCCGTTCTCATGGAGAAA
ACGGTTCAGTCGAATTCGTACAATGTGAGTACGAGAGCTCAACGATTAAATACTTGGCTTTGTGCTTACGCCATAACATTAAATGTGAACTCACCAACAA
AGTCTAACAAATTGCACAGTATCGTTAAAGGGAGCTCACCCATGATACACCCGACCTCGTACATTTCTGAAACTCGCTCTTGTCAAAACTGCTGTGAGTC
ATGTTTCACAGCGAATGGTGACTAAAGAATGGGGAGTATCTAGCTGGGGTTTCATTCCGGTTCGACGGGGTCGTGGCGCGGCAGTCCGCTTTGAATTGAA
GAGGGATGCGGACTACGAGAGCCTTCAAACACCATACTGCATTTTTGTATGATCAATTCATTACGCCATAGTCTTCAACCAGGTTCTCGTAAAAAAGTCT
AATTAGGCAGATTAGATCGTTTATGCGACATATGCCTCGTTTGTTGAGCCTGCCTATATTTACTGACCACGTGTATTCGTGCACCGCAGTAACGAAACGG
AATAGCACTCCCACTGCGTTGACGCACGTCCATCAGTCTTTGTTGTATGATTTGGAGAGGTCTGGCAGCGATATGCATTCCAGATGTATGGCTTCAGCAA
GCACATGGCTGGACTCTCTTCCCGCTGGTACACTCATCGTACTGTCTCGGGCACGTGGAGGGAGTTTTGACTACTGTGAAACGCTTTTCGTAGGCTTGCA
TCCATGTGAGCGCTAGTGGCGTGCGTATTGCTACTCAACTCGTCGGAGCAAAAAACTCATTAGCGGCGTCCACATCGCTAGGGTAGCTGTACATGCAATT
ACCACGTAGCGGGGCTTCCCGAGGGTAGTTTTCAGACATCTACGGTGTGAACTGGTACTCGTGGGACCATAGTTTGTGGCAGAAACTATGATGACCACCA
TGGATCTCGGCCAACCTAGAGAGCCGTACTTGGAGCAATCCACGTTGACCGCCAGCCGTTGAAGTCATCATAGTTGACCCGCCTTCCGAAGCTGCGATGG
CGAGCTCCTGCCAACTCCGGCCAGGTGTTGTATCTTCCTTTGCTTTTTCATGGTTCTGGTGTCGTTGGACAGCGTACTCGGCACGAGAAAGCTTTTACAA
CAAGCTATACGCGCCATAATAACGGGCATGACGTTTGAATTCCATCTTCTACGACGGGACGGGACCTACGCAAGGGTAGATTTTTACCTGGACTCATCGA
TGCATACGAACGTCGACCGATCTCACAAAGGAGACGCGTTGGAAGTCGTGTCCTCgtagttgaagtgctcgatCTTGCGTGAATGGGCACGGCCGAAACG
ACTTCTTGCCCAAGCACTAGGCTCGA