Description :
Non Conding Region
Location :
Scaffold_1:85426- 87845
Sequence
2419 bases(100 bases per row)
TCGCCGGCAGAGAGCGCCATTATTGAGTGTCTTGCACCGAAAGAAGGTGGGAGATACGATGGAGGCATATAGGGAGTCCCTGTGTCTGTGTTTTGCTGTG
GTGATTTTTTTTTGTTTTTCACGGGGGAAGGTTGAAGTTTTGCTTTGGGAAATAGTTGGTATTACTTTTTTTTTGTTTTTTTTTGTAGTTTTAAAGCGGA
GTGTGGAGTAAGGCGAGCTAATAAATAATAAGCGAGTTGGGATACAGAATGGCTTGGCGTGAAACATGAACTTGTAGCGCGCATTTATATATTTGCGACC
TATGCCCTGTGTGGCCCATGTGGTTAGACAATGGAGTGCGCTTCTTAAATGCACACGAAGCGTCGCGCTTTTGCTTGTGTACTGTATGCGAACTGCATGC
ACGTTAGTAATAAGCAGCTTGCCACCAGTATCTTCCTTTCCGTAAAATAGCATCACAGCCATATTGCCTTCCAAGCGGCATGATTGCCTTTCATGCTGGG
ATCGGATGGTGTTCATTCGTGGAGTTTAGCGGACGGAGGCGTCCCCCACGGTCCACTATGGAGATTCGTGAGGGAGAGACGCCCAATTTTAACAGAGAAA
AACGGTTCAGTGGCGTCTCTGCCGTCGTAATCAACGCTTGCTTTTTGCTTTTTATGGAATGTCATGTGGCAAAAATTACTTCTATTTTTTTTAGACACGG
TGGGTTCGATTTTCCACTGGAGCGCAAGGGTCGATTTTATGTTTTTACTGATCACATTTTGCGCTCGAATTACGGATGCAGGAAAGCTAATCTGCTTGGA
ATTAGGATATCGCAGCTGGTAATTCGTAGGTATCCGCTTGCGTTGCGTTGCAACTGCAGTCTCTGCGATGGGTTACACACAGGCAGGTGGTTGTGGTTGT
TGTTGTTGAAGCAAGCCACCTCACCCCACCCCATGCGTGCGGTTGATCCAACCTGTAGCCTACAGGTTGGATCGACCCGCACGCTATGGTACGGCGTAGC
ACAGCGTGCGTATGTCGTCCTTTTGGCAAAGATGCGTGTACTGCAAAACCACGACGACACGCACGTCCGTACAGTACTGAGCAGGCAGGTAGGCAATCAG
GCGGTGACGCGCCCCGGCGAGCCAGACGCTCCAGTAGGTGACGTCGTCGTCATGACTGTGCAAGTATGTAAGTGCGCATTCTTTCTGTGAATCCGCGGCG
TTTTCGCATATCCAAATAGCTTTGTCACACCTCAGCGGAATATAAAATACGCACACCGTTGTTTTCAGTACGAGTCAAAGCGTTGTACCGTTCGTTTACT
TTTGGCGTGCTCCAGTTTACCGCACAATCCTGCTCTCTCGCTTGCTGCATTGCGTACGCATTCTTCGATGCTCTTTCTGGCCGCTGCGAGCCAATCAGAT
GCGTCGGCAAGGGAATTGCGGCATATCCAACGTGCCGAGCAGGCGCATCCGTTGCAGCCGCGTCAAGTGCCTGTTGCAGGTCGGTCGGAGTGGCTTCAAC
TTGCGGACTCGACTAACTGACTGGTTGGTTCTATAGTGAGGGTCATGTGGACAATTCCGCCTCAGATGATGGCGAAGAGACATGGAGAGTGGCGGATGTC
CCACAGATACCCGTCAACAACACATATCCCACACTACTCAACCCGGGTTCTCACAACCCACATCTCCAATAACCCACTGCTCCTCCATTTTCATACAAAA
ACGAAGTTAAATGCAACCCACGGGTTGTTCTCTTGACCCGGTTTCTTTATTTTGCAATCTACTGAGCTTGACACAAAGCCACCCCTACCCCGTCTTTTCC
CCGTTTCATGGAAGAGAAAAGCTCCCTAGAAACCAAGATCGCAAGATCGCAAGCCACATGCACCCCGTCTGCTCCACAATCCAACGACAACCATACGCGC
CACTCTCCATTATATTTGTATAATATGCTGCCCCCATACAAAAGCGCCACCCAACGCCGCCGCGGAAAAGCCACCTCCCCCCTCCTCCTTTCTTCTCCCT
GCGTACATATCGGAAGACGCTGGCGTAGGCGGGAGCAGCGCGCGAGCGTCGTACCGTCCGTCCGTCCCCCTTGACGTTCGTTCATTTCGCAGCTTCCCCC
TTTCGTACCCTGCAGGTAAGAAGCAACCAAACTCACACGCGTGAGTGCGCGCCACCCATCCGTTTGTAGCTCTTGGCGATCTTTTTGGGTGTGGCGGTTT
TACATACGAGTCTGACGGAAGATCGCTTAGCGCACGCACGGTGAAGCAAGTGAACCGCGCGCGCCTCTTGACGAACAATCCGCAATCTGGCGACGCGACG
CGCCCAGACGCCCGAGCTTTCCCGCGCGCGTCGAGTCACGTGAGTGAACGAACCGCGTCCTACTACCCGCTCGCTCTCTCTCTCTGAGCCTATTGCTGAA
TTGTCTCGTGGCAGCAAGA