Description :
Non Conding Region
Location :
Scaffold_1:85394- 86078
Sequence
684 bases(100 bases per row)
GGCGTGTTTTTGCTGCACTTGGGAGTAGGGGTAGGGCTGAGTCTTGCCAGCGGACCGACTGTACACGCAGATCTACTAGCTGTGGCCTGGGCTATGGCTA
GCGAGTCGGCGGGCTGCAGTGGCTGCGGCTCGAGCTCGTGAGAGCGACAGGGTCCAGGCTTCTCCCTACGGATAGGTGGTTGAGTTCATATCTTTTACAC
TCGGTATACAAGAAGCAAGTACTGTACAAAGGGTTGCTTGAGATTTTACACTCATGACTGCAATGTGGAGTCGCCAAACCTTCATTTTCCATTTTGCATC
CGACTGGCCACAACCACCTCCGCTTCCTGTAGCCTCGCGAGACTGCCCGCTCCGCTCTACTCGACCACCCACTCACCAACAACAACTAGGACTACGCGCT
CCAATACCGACAAGAAGCAGGAGTAGCGCGACGCCTCGACCGCCGCACAGGCCACTCCACAGGTGGTTCTGGACGAAGTTCGTCCGGTGTTTGGCTCGCC
AAGCGCTCGCGGTGATGAGCGAAGAGACTGCGACGGAGGAGAGCCTCCGTGCACTCAAGCGCGCTTTGCTGCGGCGCGACGGCGGTCGACGTGTCGTAGT
GTAACAACGATATAGATGCGGCCAAATAGGACAGACGTGTGGCCTAGTGCTGCCTACTACTCAATGTCCTTGCTGCCATAACAT