Description :
Non Conding Region
Location :
Scaffold_1:85317- 85419
Sequence
102 bases(100 bases per row)
CGACGTCTGTTGAGCAAGATGAGAAATAAGGCGTTATCAGATCCGATCACTCGGCTGCACATCTGAGAATTCTGATTCTCATTTGCAAAGCCACTTCCAG
TA