Description :
Non Conding Region
Location :
Scaffold_1:8530- 8607
Sequence
77 bases(100 bases per row)
GCTTCCCCATTAGAGTAAATAAGATATGTCGTTGTCGTGCTTTGAGCGAGGCGCCCCGCATCGTTGTTCCTAGCTGC