Description :
Non Conding Region
Location :
scaffold_1:85261- 86657
Sequence
1396 bases(100 bases per row)
GTTGCGTCGGTAGGTTTGGTACTCAACTTGCTTGGTCGGAGGCAAATCGCGTTGTGAAGGCAGCAAGGTTCATCTCAAAGTGGCGTGACTTGATCCGAGA
TTTCCAAGTTCTCGCTGACGTAGCGCTGCACTTCAATCTATCACCACGATTGAAGCGTGGCTGTGTTTTCCCAGCAAGTTATGTTTGTTTCTGTGGTTGG
TCATTGGTATCTGCATCACGAGTTTGCATGCAGAAGAGAGACTTCTGTCGTTTTGAGCCGTAGCATCCCTGGTCGTGTTAAAATTGAAATAAATGATGAA
ATTGCTCAAATCGATCGAGCAGAGTCAAAACTATGGACTCAGCTGAGGCTTGTGATGTCGCTGGTAGAAAACACTTTTGAGTCCCAGGGTGCACAAGGTC
GTACCGTGAAGGAAAAAACGTTTTAAGAGAATCGATCCAGCAACACAACCCTGAAAGGTTCGCCACCCCGTTCTTGCCGGCGATAGTCGTCCACCATTGG
TAAATAAAACTGTCTCGCCACTCACTCCCTCCTTTCAAGAAAATGCTTTACAATTGTGAGGGCTTTGACTACATGAAGTACAACGGACTATACTGCATCC
CCGTCGAGACAATTGTGTTCACGGGGTACCTCCTCGACTATGGTAACAACAGCAACGAAGCGTCTTCTGTGCTCACTCATTCAACAGTTTAATCTTGCGA
TGGCATTTGGAAGCATGAAGATAAAAAGATAGCTCGTGCAATCCACGCCATCCAAATAACTGAACACGATAGCGCAACAATAAACCATTTGGTCAGCTTG
AGGCTTGAATTTACTCGCTTCCAAGTTATCAAATACTACAAGGGTTCATTGTTCACTTTAGAAAAATAGAACGCCATCGTAGACAGCGTTGGAGCTGAAT
GCGGTACATGAAGAGACCCCGTCTCCAACATATCATATCAGTTTGTTTGCACTATCGACATAAAATATGAGAAGCGTCTAGAGTTTGCTAAAATAATACT
ATTTCTTATGAAAATACCAATAGTCTTTTTTTAATATTCTGCGTTCAAACCGCACTGCTCCAATATTTCTTCTGGAATGCCTGCCAGACAGGTATTGTCT
TGCATTTAGTACATAGCAAGTATCATATAATACATGTAGAAAGAGTAGACGGCTTCGTTCTGGGTCCCAAATGGAAATTGTAGATCAAAATGAGATCAAA
CTAGAATGCATCACCTTGTGTATGCCTTCACGACGTACTTCTCGTACATTAAAGTCGTAGGCAAGAAAGAAAGTGGGTGTTGCTTATTTCATGGGCTTAG
CAAAACGTGAAGCGAAGCGATAAACCGCACTCTTAAAGAATGATCCCACCAGTTGTTCAATGTCGACTGGCTGACAGCAGCCTTCTCTCCAAAACT