Description :
Non Conding Region
Location :
Scaffold_1:85195- 85507
Sequence
312 bases(100 bases per row)
AAGATATTACAGTAATCTTCAAAATAATCCGCATACAGCTGGCAAGACAATAAAAAACGATTGGGCTTCAAAGGGAAACTTCCCAAACTTGGACGAATAT
ATATTTAGGATATATCCTTCAACTCGACATTTGGTCTATCACGACGACAAGCAACGACAGCAGACGCTACACTATTTATAGTGAGGCATAAGAAAGTATC
AACACTCTTGTGTGGGCGATACGCTTCAAAGCAATATTCTATTCGTGATATTTACTTCCTTGAGCCCTGGGCTATTCTACTTACATAGTCTGTAGAATTG
TCCTGGTATGTC