Description :
Non Conding Region
Location :
Scaffold_1:85166- 95395
Sequence
10229 bases(100 bases per row)
GAAATGAGCAAGGTTAACAAGGCCTTCGCGTACGTGTTCAACACGCCGCAAGAGTACCGGAAGGTATCTCGCGTGCTGAGTGGCTGCGATGTCGACGACG
ATCCCAAGGTCGTCGACGTCGAAGCGCTTGACCACTCGACGCAGGAACACCTTGGGCGCTTCCAGGAGCTCCTGTACAGCACATCCTTGGGCCACAAAGA
TCGCCCGTTCAACGTCAGTTGCAAGGTCCTCATAGTACTCACCGCGTACTTGATCAAGTACTTCCCGCAGCTAAAGGCGCTGTCGCCGGGCGCCCCGATC
GTGACGCGACGTAGAAGAGTGCTGGAACGTCGCTGGAATCCCGCGAGCCGATCTGCTGGCTTGGTCTGCAGTCCTGAACCACTCGCCGCCTCAACCTGAC
ACGAAACGTAAGCATAGAGAAGAGAAACAGGAGCAATGTCGGGGATGTCATCAGATGAACCGCGCGTTGAACGCTCGCCTGACTGTCATGGAGACCGCCT
AAACAGATTCAAGCAACCACTGAAGAAACACAACCACCTGCCGCGTTAGAAGACCAACCCAAGCCCAAGCGCAGGAAGAAGGCAGCTACGAACCTTTCGA
CGACGTGGTATACGCGGACGCCACGCGTCTGGGACTCCAGCGAAAGTCCGAGTCGCGTCACGTCGTCGCCTTCATGAAGCTCTTTCTGGACGGCGGCTTC
ATCCTCGACGACACCTCGGAGGACTACAAGGCCCAGGCGCTGGACGTTGGTGTGGTGAGAAGATCCGCTCAAGAAGGGTCTTGATGGGACTGGATCCGCC
AGTTGACTGGGTAGTGGGATCCGGCAGTTGGTGACGATGCACAGTCCCTCTGATGACGCCATGGTTGCGGGATGGAGGTACGGTTGCGGGATCAGGACAG
TTGAAGTTGGATCAGGTGCGAGTGGTGTGGTGTATTCGGATCCGCTCATCTATATTAGGATCTCCTAGATTAGGCGCGGATCCGTACCAGCTTATTGGTA
CAGTGGCTATGTTGGGATAATTAGGCAGGAGGGAGAGCCAGTCATGGATAGGATCCAAGTCGGATGGGAAGGCTGGGTACAGGCTAACATAAATCAGAGT
CGAATTTGCTTGGGAACCACACACTTGGTCCTTAGTATTGGGATTAGTATTGGCCCATACTTTATTCAAGTGATTTGCCCCCCGCACACGTGGCAGACTG
CTGGATAGCTTGGCCAGCAGCTCGCGCCCTTCGGCCCTCGCCCCCCAACTCCCCCGCTAATAGTAGGCGGCAAGCGACGTAAAGGAAAAGGATACAACAC
CCCCAACAAGGCAACAACTCCGGATCTGGTATATTACTTATCGGATCCACAAGATCTACGGCCAAGACCAAGGATCGACCTACCCAGACCCGCGTGAAGG
AACCCCCACTGCGGATCTACCCCAACATCTCCCTAAGTCCCCGCCAAGGACGTTCAAGCTCACCCGCTGCGCATCTCGTGTCAACGAGAGAGCAGATCCA
GCCCGCCGACGGGTACACAAGGTGAGCCACTCAGCAACCTACGGTTATCGGAGTACTGAGGCGAGGCGGGTGAACGCCTTGATCGTCCAGGTGTGTAGCG
CACTATGCCGGACCGAATCGGTTCGGAGTACCAGAGATATCCGCTGCAATCCGGTAGTCCTCGGAGCACAGGATGTGAACCGGGGACCGGGCGGATCGCT
TGGACTTGGCGTGTGTCCTTGTGTCAACCCCTATAGGTATCGTTTACCTTTGGCGGACCGGACTTCACCGAGTGAGTTGTTGTAAATACAGAATCGAGTG
TTCCTGAAACAGACTACACCGAATGAACAGAAGGTCAGACCGAATCGAAGGGACCACAGTCAGATCCACAATTCAATATAACCAACACACAGAAATACAA
TGCCGAGCTAAACGTCACAAAATATACAGTCACCACTTATTCTTTAAGACCCGGTCTATACGCCAGTCAACTTACGAGCCGTCACCCAAGGCACTGGTCA
ACCCTGGATGCACACTCACTTACGCGCACCACCCTCACAGAGTGAGGGAACAATACAAAATATAAGTCAATCCTATCACACAGTAGTCGATCAATTCAGT
CTCGGGGGTGACTACCTCTACCGCCTAAGACACACAGGATGGAATATGAAATGGATGCCCGGATAGAGCACGCAAATTGGAAATAGAGCTCTCATAGATC
ACTCCAGGGCGCGACACCCCAGTCCCTGCCGACTTTGCCTTGATACCTTTGAGTCCCCACTACACCAGTGCTCGCAACACCAGTGAGGCCTTGAAGCGTC
CTCCGTTTTAAGATCGCACGAAGGCGGATCCCACGTATAAGCTCTTGAAGACGTCAATGTCAGGGGGAATTCCCAGCCCGAAGAAAGACGCCCGCGTGTT
CTCGGCAAATTGGTTTCTGTTTGATCTTACGTTTGGCTAGCTATCTACTTCACTTCACTGACTTCTAATAAAGGTTTCACTATACTTGACTTGTCTTGGA
TATGCTTCGACCTTGTGCACGGGGCTTCGATCTTCTTGCACTGAGCTTGGGTATGCTTGACTTGGCTTGGTTATCGGGCAACTTGTCGACGTCAACGTTC
CTTCGGCAACACTCATCATCTGGCGACAGAGGTACGTGGGTACGGCGTCTCATCAAATCCGCACTGGACCTCTGCGTCTAATCACGTGAGCCATCCTGTG
TCGCTTGACGTTCTTGGTCGATCCGGTCCTGGATTGCTGCCACAGTGCATTCACGCACAGCACTATTGGACTTGTTGTTGGTGCGGTCACGATCCAGTAT
GGGCACCAGGGGTCAGACCGAATTGACCATCCGGTCCGACCTCATTCGGTACGGCACCTTGGCATCCGGTGCGTCGCTACCGGGTGAACCACAATCCAGT
CCGGCAAACAGTGTTCTTCGTCCAGCGAGGTCTTGGGCGCATGGGAGCATGGTGGGCACGGTGAACTTGGGGGTTGGTCCGATGTCTTGAAGGAGCCAAT
GCAGGCAGCAGCCAGGATACGTTCACTGGCTGCACTTGCGCGCCTTAGGCTTATCCTGCGGTCAGGGAAGTCGGCGGACGGACAGGATGTGTTACTCCAC
ACCGAATATGAGCGCTCATCCGGTGGGCACATCTCCGATCCTGTGAGCCCATGCTTACTGCAAGCACCGGGTCCCGCCAAATCCACCATGCGCATCCACT
ATCCACATGCAACACTCCACGTCACTGGATATCAGTCCACTGCGACCAGACAGAGTCAGTTGACGATTCGGTCCTTCCGGCAGTCCAACACGAGTACGGC
GAAAACTCTTCTTCCACATCGTGTCAGTACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTGTGTGAGTGTGGGATCCCTGCTAATTCCAGCGGATCCACT
CCACCACATTGGCACGCGCGCTGAGGCAGCCCTGCTGCGGTTCTTGGCGTCCCGCGGCATCAAGGCGAAAGGCTCGGGAAGCGTGCTCCGCGCTGCACAA
GACCGGTGTCTTATCGCGGCACACAAGCGTCTCGTCGCGATCGGTAGTACCCAAGACCCTGCCCCTGTAGACACGCAAAACATCCTTGCCGTCGTTGGTC
ATGTCTAAGTCGTTAGATATCTCCCACGCAAGTACAAAGCAGAACGAAGACTACGCAAAAGTATATACAGTTACATTGCGAACGCACCAGCAGTAGCATC
TCGGTAGCAGCAGCCACACACTCCTAGGGTATCAGCACACAAGCAGCGTCACACGCAGCTTAGCGCCACCCCGTCCGCTCCCAGCCATGATGATTAGCGC
CGACCCGAATTGAACGGGTGTCTCCAGATCCAAAGCTCGGCGCTTTTCCTTTGAGCTACGGCGCTGTAGGTAGGGGTGGAGTGGGGGGGGGCAGCCTTGG
TCTTGCTGTGGTGTGTGCTTGGCGGCGGGACTTGGTCGGGAGACTTGAGCACTAGCGCTTTAAAAAAGAGGAGTGAGGGCCTTTGGCTTCTGTTGGCTTC
GGTCGGCGACGTCTCAGCTGGTGGCGACAGTTGGCATATGCTGATTGGCTAATCGATCAGCCAACCAGAATTATGTAAGTCTGCTATTGATAAATAATTA
GACCAATAGGATGCCACACCAATGCACTGCCGGCAGAGTTTGCTCCAAATTGTGGCCCCCCACGGGAGTTCCGGCCTCATTAATGAATTTGCTCAGTAGG
GTGTACGTCGCTCCAGGGTCATAAATGCATGCATATCTAAAAAGTCGAATTCTCGACCCACAGGCCTCTAGAGGCAATTTCCTCGCGGCTTTGAGCACCT
CATGAAAGCTGACTGGAATCGCCCAACTAGACCCCTACCCCTAATCTACAGTACATAGTGTTTTAATTCCGATTGTGCACTGGCTATGATAACTATCCTA
ACTCTCAGAAACTGTTGGGAAGCGCGATATGCATTTATATAGAAATTTGTACGACATTAAAAATATTCTGACAAAATTCCAACCAAATATGGTTGGAACA
GTTGGAAAAATGCCCTACATCAGAAAGGCTTCTGATTGGCCAAAATTAGTCGAATTTAAGGCATTTATTGGGTGATACTCGTCGAGTACGAGCGGTTTGA
GATTGCAAAAACGAGTAGTGGTTGGAATAGAGTGAATATTACTCCATACCATGAAATCTCCGACCTCCGACCTTTTCGACAAATTGGTGTGACGCACATA
CAAATGTACTGAGCATTGTATGCCTATAAAAATATTCAATGCGCCCGTCAAAAGATAATTATGCGAAAATAATGATTGGCATTGGGCACGCGGGGGTTGC
CGCAGTGCGCGCACTGTCAGTAACGAAGCGACCGCGAAGTGATGTCTACGTGTGCCGAAGTAACCATCCAGGAGGGCGAATTGATGGGGCCGTGCCGCGC
ATCAGTACGGCTAAGAGGGGCTGTCGCTCACACAAAGAACTGTGTAGAGTTAATCCCACCTTCTGGCGCGCAGGTGAGTATCCCTGCTTTGAGGTGTGCT
GACCCCACTAAAGTAGCTCAATGGCGGAGCTCTCGAAAGGGTGGTTGTGGATTCGACTATGTTATGGGTTATAACGGATATTCCTGAATAATCCCCCGGG
CACAACTGATTAGTGCCCTCCCATTTTCAAACAAAATCAGATAAATTGTGGATAATACAGCGGGTCCGGTAATTGAAGGTACCCCATGTTGAAGTGCACA
TTTTGGAACATCCTGGAGGCTGTAGACATCCGTTTGGCGCGCAACTTGGACGACACGACGCAGTGCGACAGCAGCATCATTTTACACTACAGTATTTACA
CTAAAGAGCAACAGAAAAAATGTTTTAGCGAAAGTTATGAACTGCCGTGTGCAAAAGTGAAGGTACTCTCTATTCCCATCGATCATGATCGATATCTGAT
ACAAAAACCAAGTCAAACCTTGAAGTACAACCTGAGCCTAGTACTTGGTGTGACCTCCGCGCGTTTGCTTCACCGCATCAAGGCGCTTTGGCATCGACCT
CACGCACTTCTTGATCATGTCGTCGTCCAGCTCGGACCAGATGGTCCTCAGCCTCATCTTCAGGTCGTCCAGTGAAGAGGCAGGAGTCTTGTTCAGACCG
CGCTTCAACTCAGCCCAGACGTTCTCAATTGGATTGAGGTCTGGGCTTTGAGCGGGGTGTCCTAAGCTCTGCAGGTTGAGCTCATCGAGGCACGACTTCG
TCTTCTTGGCTCGATGAGCCGAGGCATTGTCCTGGACGAAAGGTGTGGGGCTGGGCAGGTCATTCAGCTGCTTGGTTATCGGGATTTCAGATCGTAATAT
CTTTCGGTAGTACTCCCCCGTGACGGACTCCTCGCAGATATGCAGCGTCCCCACGCCGTTACCGCTGATCGAGCCCCACACCATGAGTGACCGGCGGCCA
CTTTTAAACGTGGAGAGCCCACACTTCTCCGAAAAGCTCTCGTGAGCTCGACGCCACACGGACACCCGCCCAGTCGTACCATGAAGCTCTGCCTTGGCCT
CGTCAGTGAACAGCACGGCCTCCCAGTCGTCCGCCGTTGGGTCACCGTACTTCTTAGCGTAGGCCAAACGCGCTCGGCGGTGGCGCGGCGATAGGTAGGG
CTTCTTTCTCGAGGAGCGGCCGTTCAGACCGACCGCGTGGATCCTCAAACGGATCGCCCAGCGCGAGATCTTCCGCCCAATGTCCTTGGTAACTTGGGCA
GCCAGCTGCGCCGCGCTGATGAAGCGGTTGGCTTCTACTGCTCGAACGATTCGGCGGTCCTGGCGAGCGTCCATGAGCTTTTTGCGGCCTCGGCGGGGCG
GAAAAACAGAATGTCCATGTCGCTTGTAGAACAGGACGATATTGCGAACGGAGTTCCTTGGCATCTCGAGCATCTTGCTAATCCTAGTGTAGCCCAGACC
ACGTAGGTGCTTCTGCACGCAAAGGAGCCGCATGTCGTGCGAGTACTGGTGGCGTTGGCGCCCCATGGGCTGCAGGAGGAAGAATGAAGAATGAGCTACG
ACATCGAGGCGCCACCGACGTCCACAAGCAGTTGCAGTCCATAGGTTTTGGCGGCAAAGTTAGTGCAACATTTGAGCAACTTAAATTTCCCAATACAAAT
TTCTATATAAATTGCAGAGAGTTGCCTGGGTACCTTGACTATTGCACATCCCGATTATACTCTATCGATGATTGGTGGAATACTATTGCGAAACACCAAT
CAGCGCTTTGGAACCGAACCCACAGACGAATTCTGCATCGTGTGGTCCAAGTTGCGCGCCAAACGGATGTCTACAGCCTCCAGGATGTTCCAAAATGTGC
ACTTCAACATGGGGGTACCTTCAATTACCGGACCCGCTGTACACAGCTCACGCGTAAATATGTTTTGGATAACAAAGTCATAAACATGTACTTGATTTTT
GTATGGATGTAGCAATGTAACCATGGGATACGTACGTTTTAGAGGGTGCTATACGGGTAAGGGGCATTATTCCTGAATTTTCGTTAAATTGTTGTGACGA
CATCTGCCAGAATCGTAGGGAACGCTGTGCTCCGAGCTGGTCCACTTGCAACCATCAATTTTAGCCAGCCACTCTCCTGGGCTTGACCGGTAATCCCGGG
CCGACAGGCCCGGCGGTTCCCGCCACCTTTCGGGTGGCGGGCCGCCCGCCCGCTCTAGTGAGACTCTAAAAAAAATAGTTTGCAACCATCGCAGTTATGG
TAGAGAGTGCTGCGCGTGATGCCGTACAGGAGGCGATAGCGTTGAGAAGGTTCCCCCCTAAGCTGTGTCTACCGGAACAACATAATAGGAGTTTGCTGTC
ACTGTGGCTTTCCTGTTCCCCCGGTAGCGAAGAAGCGGCCAGCGTGTGAAAGCTGCCGAACCACCAAGCGAAAGTGTGGTCCAGACAGCAGGAACGTAAA
GTGCCAGTACCGGCAGCAGTCAAACCCCACGATAGCTTCGTTCTTTGCAGCTTCAGCGAGTCGCACATCAGCCGACCAGTGAACCTACTAGATGCAGCAG
CAGAAACATTTAAAACACGGAATACATTACCAACTCAAAGCCACACTAGTTATTTGACCGTAGTAGGTGACACGCTTACTATTGTTTCCACTGCTGCCCT
CCACAGCATGGGCGCCAGAGCCTAGCAGGATGAGGTTAGCGAGAACACGATGCCTTCGTTTGTAGCAGGTAGTGCCGATGAGCTCATAGCTGAGTTGCCG
CCTGCGATACTGGTAGCTACAGTCTGCTGCTTGTTGCTGTACTGAATCTGCGGTGGCTGTGTGGAACTCAGCGCCGCTGCAGAGACGTCGGGTGTGACGC
TGGGGATACCCAAGACGAAAGTCTTGCTGCTCTTGGCGCACTACACGACCTCGTGCGCCGGCAGCACAGGCACTAAGGCTGCGTAGCTCTTCTCGCCAGC
CTGCAGCTAGTTATACAGCGTCCAGCCCCGCTATTGCATCGTTCATTGAGTCGTGTCATAGTCGAACGTACTAGATGCAGCAGCAGAAATGATGAATATC
ACGCAGTACATCACAAAATGTCAGCTCTTTGGTTAGCATCACAGTAGTAGATAGATATCGCACACGTACTTCTTTTGAGAGCGACACTGCGTGGGCATCG
GAGCCTCGCAGCAGGAGCTTGGCGAGAACTTCCTGCCCTCGCTTGTAGTGACTGAGGGCTTCGTACAGCAGTGAGGATCGTGCAAAATGCGGCTGTGAGT
GGTCGGCTGTTGCTATTGGTCAATTATTCTCGGGGTCAACTGTACATCTGTCAGTACAGCAAAGCGGTGGTCAACGGTGGTCAACGGTGCCCGCCGGTCG
CAGTACAATCCCACGAATTCCGCTCCTGTAGCCCGAGTTTCGAGGCTACCACGAGCAGTTTATCTATGGAGCCTCCGGACGACACAACGACCGCATCGTC
TGCTGCGGTCCCACCGTTTACGTTGCCGCTCCCTCTGACGTGGTCCGTGACGCAGTTGGCGCCGCCGTGCAGTGCTACCACCGGAACCAATTACAGCACT
TGTAGACCGCGCGGCCACGCCGAGCCCAAGGGCAGTAACGACGCCGGCGTCCGCGGAGCGCAAACGCGCGCCGAAATCAGCTACAGCTGCCCCAACTCCC
CAAGTAAGAAGCAAAAGACGCCTGGCAAAGCGCCAGGGATCGGTAAAAAAGAATTGTAATTGTACAATTTTGGCTATTGTACTCGCACAATATTGATTGT
CGAGACCCTCGGCAATATTGTACAGAAGCGGCCAGTATCTCAGCTAATACTATGGACTTCTAATCGTAGCTGTCCATAGCGATCAGGTTCGCGATGTCGA
GCTCGTATTATTCGAGAACTAGATCGAGAAATCTTATGTGCTCATCTGCCGTCATGCTGCTCTCGTCAATGAACAACGACAAGGCGAGGAACCTCCATCC
CTTTCACGTCACCACGAATACAGCCAGCGAATGCTCCCCATTGTCGGTAGCTCCGTCGAAGACAAACACGAATCTCTCACCCTTCAGTTCCTCAACGATC
TGAGGTTCGAGAAGCTTGACAGTCGCAACCATGCGAGCTTTCAGCGTCTTCGAGTTGATCGAGTCAAAACTTGACCGCCGCACGCACGGTCTCGTCGTCT
ACGTCGGCAAAGGTGAAGTTCTTGTGGACGACGAGTTCGTTCCCTGGTAGGTAGATTGCGCGAGTCGGTCGACAAACATGTCCATGGAGACTTTGCGCCG
TTCACGCAGACAACTTCGGACGACGTCTTCGTAGCCAGAATGTTTGCTGGCGAGGTGGTTGATGAGGTTGGTATACCCCGCCTTCTTTAGCTGCTTGACG
AACTTGTTGCACGCGTTGCAAGTCTGACCTGACTCGTTGGGATCCCGGAACACCATGCGCACGACCACTTTGGACTCGAGCTTTGGCGCTTAAGAGGCGA
ACGTTGCGTTGACGGTCATTGTTGTTGCAGTTCGGTGGCTGGTCGTGAAGATCTGGCGCTGCTTGGGCTAACGCGTCGACCGATAGGAGGATGAAGGGAT
GCGAAGGGGGCTGATTGACGGTTCTTTAGGACGGGCAGCGAGGTTTGTTGGTCGAGGTTAAGAGAGGGAGGCTTGGGCGGGGAGGCTTGGGCGGGGAGGC
TTGGGCGGGGAGGCTTGGGCGGGGAGGGTAGAGGCTTGCGAGTTGATTTCAAAAGTGAGATCGCAGCGCTGTAGCGCATCGAGCTCACCCGTTTCCTGCC
CGCTCGAACGGTAGGAAGGTAGACCTATTCCAAGGCGGATAAGACACTGAGGGCAACTGCAACATCAAGATACACAATTAAATCGGCTAAGTGCAATATA
TTGAAGAGGGTATTGGTATTGTTACAATATTGATTGAGACGGCCGTCTCGCCAACAATCCATTTTCAGTATATATTGGGCGATCACTGGCAAAGCGCCTC
CCAAGCGTGTAAAGTGGAGCAATGACATAGTGGGGGAGCTGCTGTGCTTGCTTTTCGCGGACGGAGACGTCAAAGAGGCACCTCGAGGGCGCAGACACGA
AGACGAAGAAAGCCCTCGCATGGCAACACTTTGCCAGCCTGCTGTCACAGACGCTGGGCATTGTGCTGACCCATAACCAAGTACTATTTCAATGTTTGAG
TGTAGAAATGAATGATACAATACTAACTGGAGTTTATGATAACAGGTTTCCCTGAAATATCGGAAGTTGAAGTGCATTATTGCAAGGAAAAGCTAAGAGT
AACCGGTAATGCAGCTCGTGAAAGTGAAA