Description :
Non Conding Region
Location :
Scaffold_1:84991- 86118
Sequence
1127 bases(100 bases per row)
TTGTCTCTTCTTGCCTTTTTTGCGCCGAAATGACACAAATGAGCTCTTGGGAGCGCCCTCCAGCCAGGTCTGTTATAAACCTTTTTAATTCCAATACACT
GTATAATTATATTTGATACAAAAATAAGGATAATAAGTGGAAAATCATCTTCTCTATGAAGAATACCTGATAAGTGAGTTTTTCACCAGATTTGAACACA
CTGGCAACTCATTCGCACTTTAGCGAGAGTCAGTCTTTTGAAGTGGACCACTTCACCTAGGATCTTGAGGAGTTTTCTTTTCTTCTCTGGCCTTTTTTTG
TCCGTTTTTGGGCATTGACGAGACGAAAAGCGCCCTTCGTGATGGCCATCACCAGCGCCGGAGAAGGAAACGCGCGCTTCATGTGCGTACGCGCGAGTGG
GTATCTGCGTGCGCGCTCACATGTGTTGTGTTGTGCAGACAAAGGCCACGCGCGCCTGGCACACACTGCTGCTGCGGCGGTCTGTAGCAAACAAACGAGC
GAGTGTCGAACTGTCGAGCGGCGACGAGTGACGTCAGTCGAGCGCAAGCGGCGGCGGCGGCGAGTCATGAGAAAGCGAGAGGAACGCATGCGTAGCCGCA
GCTACATACAGATGAACATACTACGTGCTCTGTGTAGCGTGTGCGGTGTGCTTCTGGTGCTGTGGTATGCGTCTCGTTGTGATAAAAGCGATGTCGTCAC
GCTGCATTTGTGAGATTCTTTCGGAGCTGTTCATGATCATCATGAGCAGTCCGTTGTTGCAGACCTTGTTCCTTGCCACACGTTGCACTCACTGCCAAGC
TTTCTCGCTGCTGCTACTGAACCGCATGCCTGCGTACCTCCATGCGGTGCGGTCACTTGAAGACCGCGGGTGAAGAATCGGTAGCGATACCGGTATTCTC
GTCATCCAGGCGGGTTCTGCTGCGCTTTTCTCCGGGTTTTGCAGATACGCTCAACGCATCCCTTCCTTCTTTCCTTCTTTGCAGCCTCAACCACACCTGG
TCGCAGACGCGTGCGCTCGTTCTCCCCTTTCTCCTTTGCCCATTCGCCAACGGCCGCTTCCCGCACACAAGCAGCCTCTTCGCCACGCAGCTCTCCACTA
CGCACTCTACCAACGCACCACGTAGCA