Description :
Non Conding Region
Location :
Scaffold_1:84945- 85253
Sequence
308 bases(100 bases per row)
CTGTATACACTGCTTAGCACTCGTAAACTTTCCTAGTCTACACTAATCAACTGTAGCACTGTTGTAGTTCGGATCCCATGAATATCTGTGAACGCCAAAC
GGGGATCTCAAAAATCACAACTTCGGCCCCTGGTATCCAAGTAAAGGAAGAGAAAGCAGATGATCCTGTGCGTTTGCGATGTATGCAGCCTTGATAAAAA
CCATTCATAGCTCTCTCATGAAAACGGTGTCCCCAGAAATCTGATGAATGAAATTTCTCTTATTCGAGTGATGACCCTCGCGTGAACATATCAGCATGTC
ACTCCATC