Description :
Non Conding Region
Location :
Scaffold_1:84833- 85683
Sequence
850 bases(100 bases per row)
CTGACAGAGAGGGGTTTATTATGACGACGAGTGACTGTGTAGCGAGTTGGTGGATCGCTGAGATCAGATGGAACTGTACATCAGTCACGACAAGAGACAT
CATTAGCATAGCTCTAATTTAATCGCTCCACAAGCGTGCTGAGCGCACCTCAGAAGCTTCCGCTGCGTTCTTCAGTTCTGGTTACCAAGTGGAGGCCAAC
GTAGCTCTGGTTGGTCCTCTTCCGTGTGTGGAACGGCGCTGAACGTGCGTGGGCCGCCTGCTGTGGTGTTGTGAACGGGGCTTTCATCGCCAAAACCGGC
CTTCCTAATTATACCGTCCAACCTGTGAAAACAAATCATTCATGTCCAGAACTCCTAAATAGTTGTTGGCTTGATAGGGCAACTGTATAATATCATACAC
TTGCAAAACAGGTTGCAAGCGTCGCAAATATAATGATTACGTTCTCCATTTTATCATTTTCGCCCACCTATCCCACTTCGAGCAGTCTTCAATAGTGAAA
CCAAGTAAAAAAAGGTCCGATTTCTAATTACAAATTGGAACAAAGCCTGGATTTTGCCACAATCACATTTTCTCAGACAGATTTTAATGCTAGACTGTCG
TCGATCGACCCAATCGACTTCGGTGCGCACCGTAGCCGATGGACACATGCAATCCACATCGCGTCCTGgacattgaagatggcagccgtgtcgcttgctg
catctttgTATTGTAAAGCGGCTGTCCAGCAAAACACCGAGACGTCTAGCCGCCTATTGATAGCACTTACTTGCCATGGCTCTGCGGTTTCGAGTGTTCG
AttgctgcaggtggtgaagctAATTAATTGTCTGTGGAGCTAGCGACCAA