Description :
Non Conding Region
Location :
Scaffold_1:84736- 84814
Sequence
78 bases(100 bases per row)
agaagatctaaagttttcgcttgtctgcaacagttcaagtagtcaagacacagccccaagcacaacggtgcgtcacgt