Description :
Non Conding Region
Location :
Scaffold_1:84615- 84647
Sequence
32 bases(100 bases per row)
ACATATCCGTGTCGGCGGACGGCGCCTTCTAC