Description :
Non Conding Region
Location :
Scaffold_1:8461- 9079
Sequence
618 bases(100 bases per row)
GTGGTGGAGGAGATGACGACGGTAGCAAGTGAGGGGGTAGCTGCAGTTACTACTCAGCGCGGTGGTAGCGTGTGTACGCTTCGCTCTTTGCTCTGCGTCT
CTCGATGGCACGTGAAGAAGGGGTCGATGGACCAACGCGCTTCACGCGTTTGCTTTTCCCAATACAAATAATCGCTGGCCGCTTTGTTTGTTGGCGCAGC
CGATGGACCAAGCGCGCGGGCCTTAAGGTTGCTGTTCAAGATTAGAAACTTGTATATTTCATGCATAGTTTCAAGATTCTGTCAGTTTAGAAACACAGTC
CTTTATCGAATCTTGAAGTTGATTTTTCTGGTTTAGTTACAATAAATACGGCCTTTTCCGCTTTCACTTGGTACCTCATGGGGTACAATACAACTATCGT
CCTTCTCCAAAGTGGACAGACAACCTTGCACCTTCACACTTTTTTCCCCAACTCATCAATCTCGAGACTCCCACATCTCTGCTTGACGACCAGTGCGTGC
CTGCCGCTTCCCACTGTCGATCTTTACGCGAACATTCACTCACTCACTCCTCCATCCTCTTTTCCTTTCACTTTCGTATCAAAACCCGACGAGTGAGAGT
GTGAGAGCGATCCATCCT