Description :
Non Conding Region
Location :
Scaffold_1:84516- 87934
Sequence
3418 bases(100 bases per row)
TTTTGCACGCGCGCGCGTGTGTGTGCATCCACGCCCGCGTAGAAGGCGTCGAAGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGTGC
GAGTAGCCACCATTCTGTATATCGTTAGCTCCCACACAGAGAGAGCGCGCGTCGCTCGTCTATGGGGTTGCTTGCTTGCTTGCTTCCTTCGTCGACCACA
GGGTGCGAAATGCGCACGTCAACGTCCGAAACGTTAATCACTCTGATTAGCTGAAACTCGAATTGCGTCGTATATTCAGCCAATGATAATTGACATTTTA
CTTTACAGGACGGTCTTGTAATGAAGGCATTGGCTCTCTGTCAAGTCTTTTTCTGGAAGGCTAAAGTTGTCGCTGAAGTACAGCTAAAATACAGCTAATT
CGGGTAAAGCTGCTAAGTTCGAAAGCGTACTTAATATAAAGGAGATTTTGTCAAAGTTGATTTTGACACAACGCGCGATTCGTTCAAGTCCCCACACTCC
TTTATTGTGGGTATAACGCGTATTACAGTGCATGTGTTCACACAATAGTGCAGGTGTCCGTCCATGTTTACTTGCGCGGGAATGCGCGGATGTTGGTTCT
CAACGATGTGCAAGGAGCGACTCTACGACCAATGAGTCATGCTCGAGGGTATTGTTGACGACCCCCCGGCGCACACGGACTGACTGCTTGTTGATACTCT
ACTTCATACCCAGCAGAGAACCATCCTGGATACGCGAACGCGATGTTGCACTCATGAGTTTCAACTTGTGGGTCGTCCCAACGGAAGCCGCGCCGCCTGG
CTACCGGGTAATGCGGAACGCTGGTTTGTCTGGGCGCTCCTCACATGAGCGCTTCTCTGTAGTGCATGTGCGCTTAATCTCACATGCTGTTGGCATTCTC
AAATCGCAGGTCCATGTCTCCATGGCCAAACGTCATCATAATCAGCAACTATAGTAGTCCGCAGGCATGCAGACAGTGGCCAAGTTTCTCTTGCAGAATC
AGCGAATAACTAACGAGTATTTACGTGCTTTTCACATGCGCGCAAGCTCCTTTGCGAACCGCGTATGCACAACTGTGATTGGCATGTTTATGTGTCTTGC
AACACATGCTTCCATGGCCAATCGCCGTCATGCGCACTAATAATAATGGACAACTACACGCAAGCTGAGGAAAGCGAGAATTTTTTGGCGGAACGTTCCC
GAGAACCAGGCAGGAGCGGCATCTGGTGGTAGCGCATCCACAGCGGGCTCTCCACCCTTTACCGTCGGAGCATTTCCACACACAATCACGCTGTTAAAGC
GCATCTGTGACCCATCTGGTCACTCTGACTTTATCTGTTGTGTGGCACTACACGGATTAAACACCCATAGCAACACTATGGTTCAGTTGACGTCGCCCAG
TAATCTAATAGGCAAGACGGGTGTTTATACAGGTCTGGGCAGTAGTTGACTTCAACATTGACTTAACTGGACTGGCTTTTCACGGTAAAGGCTGTTCGTC
GGACCGACTATTCGGTCCAGTTGATTGGCACCAGATGGCTGTAGAGGATACGCTTTAGTTTTTCGATCTCAGTTGGTTATGACGAGGTCTTCTACTGCCT
ATGCTATACGTCTACAGTATGTGGCTATGCTGCAGAGCGCGAGCGGATGACCACCACCACCCTGGTCTGAAAGAAAGCGAAGCGCAGGGCGTCTCTCTGC
TCTCATTCTCCGTTTTGCTTCCTCGTGAGCACGATTCCAGCCACCAACGGATAGTAAAGAACTTCATCGGCAAAGTTCGCTCTCGCTCGACTACTTACAG
CGTTAGTACGATACAATGGTGTTTGCCTGTGTCAAGAAGATCACAGTCGCCGTCGCGGTCATCGCCGCGCTGACTGCTCACAGCGCCGAGGCGACGTTCG
GTGGTGCCTACGGTGGCAACAACGCTGCCCAGATTGGCTTTAGTGGTGGATTCAACGGTTTCCCATCCATGGGCGGTAACAACAACGGCTACAACAGCAA
CAACAATGGCAACAGCTACGGGAACGCTGGTTTGACCGGCAAGAACCTTCGAGGCCCAGTCGTAGATACACCAAAGACTGTCGCGACCCCAGTCACCGCT
AGCAGCAACAGCAAGAGCAACAACGACAATTCGCCGCAACAGAGCATCGACGACTCGTCGACTTCGATCAAGAAGCCTTCAAACCCAGTCGTGGTCACTG
CGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGACGGCGAACAAACCTACGAACGGCAACCCAGCCGCGCAGTACCAATACCCGTCGAAGGAACCA
ACGACGACCAAGCCATGCACTAAGGTTCCGGTTGTCGCGACACCGATTCCTTCGACCAAGTCGACTGCACCGCCTACACCAACGACTACCGCTCCAAAGA
TCACGCCAGCTCCAANNNNNNNNNNGGTGGCAATGGTCCAAACCCTCCAGCTCCACAAGCTACCCCTGCTGCGACAACTCCAGCTCCAAAGGCTACCCCT
GCTGCTACTACCCCTCAAAAGCCATCAACTCCTGCTGCAACGACCCCACAAAGCCCACCAACTAACACCGGTAGTAATGGCCCAAATCCTTCAGCTCCAC
AAGCTACCCCAGCGGCAACGACGCCAGCAGGCGGTACTAAGGCACCATCGCCAACTCCTGCTGCTTCACAACCCACTCAAGTCAAGGTGCCTGGAGCTCC
NNNNNNNNNNTGAAGCTCCAAAGCAAACCCCAGCTCCAACCACGGAAGGGCCAAAGCAAACCCCAGCCCCAACTCCAGCTACGACAACTCCAGCTCCAAA
GGCNNNNNNNNNNACTCCAGTGAATTCGACTACGAAGAGCACCGGGGGAGTCGCTCCAGCGCCAACTCCAGCCGCGTCCAAGCCAAACGGGAAGGCCGAT
GTCCCAGGCGCTGTCCACGGGTACACTGAGAACAACAGCCCGAAGCAGGAAATGCCTGTCGGGAAGGCTCCAGCGCCAACTCCAGCGGCATCTGCCCCAA
AGACGACTGCTACTGGCGATGATGATGACCACCAACTCTGCGTTTAAGTGGTAGTCTTTTTCCATTTTCCAAAGGGAAATTACGTTTTCTCGTGAGTGTA
GATGTCTCTCGTAGTGTGTATGCATGGATCCATGATGGGATTGTCGTAAAAAACATGTACTTACAGTTGATCTAGAGTCGCAGTTGTTGCTTTCTCAAAG
TTTCCATTTCCCTTGCAGTTGTTATTTTCTTTCTCAACACCTTTTCATTTACGCAATGTGCGCAACATGCTCGAACTTTTCCGTACTACCATCGTGCTGT
AAAGCAAGCTCATATTGC