Description :
Non Conding Region
Location :
Scaffold_1:84494- 84638
Sequence
144 bases(100 bases per row)
AGATTCGAAAATAACTCGTCCCAAACTCATTTATTTACCGTCATTTTCATTTTTTATGTTATCTTTTGGCAAACTTCGTCAACACTGCTACATACACTAA
TATCGTATTAACACACACAACATAATGAGACGGCCACGGAGAGC