Description :
Non Conding Region
Location :
Scaffold_1:8447- 8598
Sequence
151 bases(100 bases per row)
GCCTATCCTCGCCGTACGAACTGCCACGCACCAAACATGAAGAGCGAATAAGTTTTATGAATGCCACTGACTGGACTCTCTGCTACGTTGTTTTCAGGAT
CACATCTATATTGCTGTGTTTCAAGTGGTGACGAAGGCTAACCAGTCAAGC